Closed williamdlees closed 6 years ago
Hi William,
hm... sorry about that. So that assertion is while it's looping over the hmm output file, and it's checking that the same group of sequence ids wasn't already read from the file. I.e. it's failing because it read the same group of queries more than once. I've never run into it, and I can't really say why it's happening in this case (if you can pass me the input file so I can replicate that'd be great), but that said it's not that big a deal. It's most likely the seed sequence somehow got annotated twice, so I've changed it to just print a warning for the time being here. Let me know if that helps.
ah, nice, I replicated it, so no need for your input file. I usually run parameter caching as a separate step before partitioning, so I'd probably never run with the combination of auto-parameter caching and partitioning with a seed sequence (on multiple processes, which caused the duplication for, uh, complicated reasons).
In any case, that ^ fix should be fine for you, and I'll push a more permanent fix later today.
ok I pushed a better fix here. I also noticed that besides the duplicated seed seq (which shouldn't have had an effect), I was removing non-clonal sequences before doing parameter caching. Which, well, was the idea with seed seqs -- ignore everybody that's non-clonal. But the parameters will be more accurate if we cache-parameters with the entire sample (particularly the germline, and particularly if the seed family is small), so I switched to caching parameters on the entire sample, and then removing the non-clonal sequences.
Thanks for the quick update, Duncan. Has fixed the problem: Partis has run through to completion now.
Hi Duncan, I am trying to partition clones using a single seed with the command
nohup partis partition --infname P2_atleast-2.fasta --outfname partition_BO2C11_clone_1500.csv --n-procs 15 --seed-unique-id 1GTTCAAACAAACTAACATAACT &
This leads to an assertion error implying (to me) that the seed sequence doesn't survive processing. I can, however, see it in _output/P2_atleast-2/sw-cache-819604701847066121.csv and it appears to be parsed as a functional sequence.
My Partis code is up to date.,
Thanks for your help.
Full output:
caching parameters vsearch: 302424 / 303739 v annotations (1315 failed) in 29.0 sec keeping 43 / 239 v genes smith-waterman step seqs procs ig-sw time processing time 1 303739 15 247.1 230.7 2 26734 15 22.9 warning for query 1GCCCCTACATACTTACACACTT: k_v_min + icheck - j_start = 293 + 2 - 294 = 1 [ < 0 or >= len(qrseq) = 1 or len(glseq) = 1] warning for query 1GATTCTACATATTTACACTTCT: k_v_min + icheck - j_start = 293 + 2 - 294 = 1 [ < 0 or >= len(qrseq) = 1 or len(glseq) = 1] 21.4 3 12552 15 12.1 warning for query 1GCCCCTACATACTTACACACTT: k_v_min + icheck - j_start = 293 + 2 - 294 = 1 [ < 0 or >= len(qrseq) = 1 or len(glseq) = 1] warning for query 1GATTCTACATATTTACACTTCT: k_v_min + icheck - j_start = 293 + 2 - 294 = 1 [ < 0 or >= len(qrseq) = 1 or len(glseq) = 1] 7.9 4 4408 15 5.4 warning for query 1GCCCCTACATACTTACACACTT: k_v_min + icheck - j_start = 293 + 2 - 294 = 1 [ < 0 or >= len(qrseq) = 1 or len(glseq) = 1] warning for query 1GATTCTACATATTTACACTTCT: k_v_min + icheck - j_start = 293 + 2 - 294 = 1 [ < 0 or >= len(qrseq) = 1 or len(glseq) = 1] 2.2 info for 299634 / 303739 = 0.986 (4105 failed) kept 17662 (0.058) unproductive removed 288815 / 299634 = 0.96 sequences with cdr3 length different from seed sequence (leaving 10819) removed 1556 / 10819 = 0.14 duplicate sequences after trimming framework insertions (leaving 9263) water time: 630.1 v mutations: 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 81 49 11 4 10 10 5 4 7 8 10 4 5 4 5 7 2 1 1 1 2 0 0 0 hv1-1801 106 147 22 14 10 8 6 3 10 7 6 4 8 4 2 3 2 3 4 5 2 0 2 1 hv1-202 85 46 5 13 11 20 18 12 3 6 8 7 7 4 2 1 2 3 0 0 1 2 0 0 hv1-4601 140 71 11 6 11 3 2 7 2 6 1 5 2 4 5 6 1 2 2 0 0 1 0 0 hv1-6901 89 184 21 8 2 5 1 3 5 1 1 3 0 3 1 0 4 0 0 0 0 0 0 0 hv2-502 100 32 19 4 7 8 3 8 2 4 3 3 10 5 6 8 5 8 6 9 0 2 6 0 hv3-1501 93 20 14 8 19 13 9 12 1 7 8 6 4 3 2 0 1 0 0 0 0 0 0 0 hv3-2101 129 29 9 10 13 13 10 7 2 7 4 4 3 1 1 3 4 2 2 0 0 1 5 1 hv3-2304 118 36 18 15 224 23 13 8 81 11 13 17 7 5 5 10 6 2 2 11 6 1 2 1 hv3-3301 38 26 9 7 6 6 6 6 6 7 13 4 8 3 6 9 10 7 2 0 4 4 2 7 hv3-4801 37 8 31 4 4 12 9 18 13 23 25 22 15 14 24 13 11 14 15 5 10 4 1 8 hv3-701 61 19 9 10 18 5 8 12 21 21 8 17 8 8 6 7 16 10 22 10 9 4 11 4 hv3-7401 140 110 26 16 8 5 8 7 5 1 3 13 1 9 1 5 1 3 2 2 1 2 1 1 hv4-3402 167 49 11 7 13 5 1 5 3 5 1 2 4 1 1 4 1 3 1 0 3 0 3 0 hv5-5101 39 75 5 12 4 3 10 9 3 0 0 2 4 1 0 0 0 0 0 0 1 0 0 0 hv6-101 sequence counts: excluded excluded excluded included actually