search

qiime2 / q2-dada2

QIIME 2 plugin wrapping DADA2
BSD 3-Clause "New" or "Revised" License
19 stars 36 forks source link

Improved error reporting for malformed paired-end reads #97

Open ConstantinoSchillebeeckx opened 6 years ago

ConstantinoSchillebeeckx commented 6 years ago

Bug Description I was getting unhelpful error messages after running DADA2 with paired-end reads that were trimmed and oriented manually with an in-house script; see conversation here.

Steps to Reproduce Behavior You can find a toy dataset that reproduces this error here. Note that in this dataset, the primer in the forward read (GTGCCAGCAGCCGCGGTAA) is present, whereas the primer in the R2 read (GGACTACCAGGGTATCTAAT) is not.