search

rajewsky-lab / mirdeep2

Discovering known and novel miRNAs from small RNA sequencing data
GNU General Public License v3.0
141 stars 49 forks source link

mirdeep2 is not generating arf files #118

Closed genesio-Ka closed 6 months ago

genesio-Ka commented 10 months ago

I installed mirdeep successfully in Mac computer but when mapping it is not generating arf files. I am using this script:

/Users/sysadmin/desktop/mirdeep2-0.1.3/src/mapper.pl study/miRNAseq-config_trim2.txt -d -e -h -i -j -m -p genome/hg19 -q -s miRNA_reads_Trim2.fa -t miRNA_reads_vs_hg19_Trim2.arf -v

Drmirdeep commented 10 months ago

What is the screen output when running the command?

did the tutorial run fine? If not then what is the screen output?

genesio-Ka commented 10 months ago

Thanks for your response. I tried running mapping.pl script using tutorial directory and I got same problem I encountered with my data as shown below: It's not mapping the reads.

res5-wm157grp01:tutorial_dir sysadmin$ mapper.pl reads.fa -c -j -k TCGTATGCCGTCTTCTGCTTGT -l 18 -m -p cel_cluster -s reads_collapsed.fa -t reads_collapsed_vs_genome.arf -v

grep: /proc/cpuinfo: No such file or directory

discarding sequences with non-canonical letters

clipping 3' adapters

discarding short reads

collapsing reads

mapping reads to genome index

usage: /Users/sysadmin/Downloads/mirdeep2-0.1.3/bin/convert_bowtie_output.pl reads_mapped.bwt

trimming unmapped nts in the 3' ends

Log file for this run is in mapper_logs and called mapper.log_62701

Mapping statistics

desc total mapped unmapped %mapped %unmapped

total: 378333 0 378333 0.000 100.000

seq: 378333 0 378333 0.000 100.000

From: Sebastian Mackowiak @.> Sent: Thursday, January 11, 2024 2:20 AM To: rajewsky-lab/mirdeep2 @.> Cc: Genesio Mugambi Karere @.>; Author @.> Subject: [EXTERNAL] Re: [rajewsky-lab/mirdeep2] mirdeep2 is not generating arf files (Issue #118)

WARNING: This email originated from outside of Advocate Health @.***). DO NOT click links or open attachments unless you know and trust the sender. NEVER provide your login information to anyone. USE Squish the Phish to report suspicious email.

What is the screen output when running the command?

did the tutorial run fine? If not then what is the screen output?

— Reply to this email directly, view it on GitHub [github.com]https://urldefense.com/v3/__https://github.com/rajewsky-lab/mirdeep2/issues/118*issuecomment-1886437198__;Iw!!GA8Xfdg!xyOgfFgbKsLZ-PnO1Y12FAOwATa20TcMVAzpTAuFdUAh0ekU4T9fZY8OAkA5YirgsDoiFJCdbMdOnL0urX5WPHYzXA$, or unsubscribe [github.com]https://urldefense.com/v3/__https://github.com/notifications/unsubscribe-auth/BFGN4QC3BJ62SHKGTCN4TE3YN6HCNAVCNFSM6AAAAABBVQW54WVHI2DSMVQWIX3LMV43OSLTON2WKQ3PNVWWK3TUHMYTQOBWGQZTOMJZHA__;!!GA8Xfdg!xyOgfFgbKsLZ-PnO1Y12FAOwATa20TcMVAzpTAuFdUAh0ekU4T9fZY8OAkA5YirgsDoiFJCdbMdOnL0urX4bbpc1fA$. You are receiving this because you authored the thread.Message ID: @.***>

This electronic message is intended only for the use of the individual(s) and entity named as recipients in the message. If you are not an intended recipient of this message, please notify the sender immediately and delete the material from any computer. Do not deliver, distribute or copy this message, and do not disclose its contents or take any action in reliance on the information it contains. Thank you.

mschilli87 commented 10 months ago

What operating system are you on and how did you install miRDeep2 (and which version)?

genesio-Ka commented 10 months ago

I am using MacOS Sonoma 14.2.2. I installed perl5 I used perl install.pl to install mirdeep2-1.0.3 packages after download. I received a message that the installation was successful.

From: Marcel Schilling @.> Sent: Friday, January 12, 2024 4:15 AM To: rajewsky-lab/mirdeep2 @.> Cc: Genesio Mugambi Karere @.>; Author @.> Subject: [EXTERNAL] Re: [rajewsky-lab/mirdeep2] mirdeep2 is not generating arf files (Issue #118)

WARNING: This email originated from outside of Advocate Health @.***). DO NOT click links or open attachments unless you know and trust the sender. NEVER provide your login information to anyone. USE Squish the Phish to report suspicious email.

What operating system are you on and how did you install miRDeep2 (and which version)?

— Reply to this email directly, view it on GitHub [github.com]https://urldefense.com/v3/__https://github.com/rajewsky-lab/mirdeep2/issues/118*issuecomment-1888714824__;Iw!!GA8Xfdg!wjGsPoz0zu0sMKRpUaKyr1xAWRyNkSvG3D7NCoF-RxLkv-hd8cv2sh-SrTxsaQS7EHzgkCQMcBqZbdlIZg1IkMKdFw$, or unsubscribe [github.com]https://urldefense.com/v3/__https://github.com/notifications/unsubscribe-auth/BFGN4QCI3UR4PGRBGPRU5R3YOD5L7AVCNFSM6AAAAABBVQW54WVHI2DSMVQWIX3LMV43OSLTON2WKQ3PNVWWK3TUHMYTQOBYG4YTIOBSGQ__;!!GA8Xfdg!wjGsPoz0zu0sMKRpUaKyr1xAWRyNkSvG3D7NCoF-RxLkv-hd8cv2sh-SrTxsaQS7EHzgkCQMcBqZbdlIZg1oOlwCwQ$. You are receiving this because you authored the thread.Message ID: @.***>

This electronic message is intended only for the use of the individual(s) and entity named as recipients in the message. If you are not an intended recipient of this message, please notify the sender immediately and delete the material from any computer. Do not deliver, distribute or copy this message, and do not disclose its contents or take any action in reliance on the information it contains. Thank you.

mschilli87 commented 10 months ago

I do have access to a MacBook running Sonoma 14.2.1. @Drmirdeep: If you want, I could try to reproduce this issue on that system. Version 14.2.2 is not (yet) available for that system, so upgrading to the exact same OS version is not an option at this time.

Just to clarify: I would try to install miRDeep2 version 1.0.3 on that system, run the tutorial and report what I get. So best case scenario, I can tell you must have done something wrong, worst case scenario I can confirm miRDeep2 (or its installer script) is broken on Mac as of now. I have no interest in doing any unpaid work to trouble-shoot anything for a non-free operating system. If @genesio-Ka, his employer or Apple want to sponsor additional work to get miRDeep2 running on their propriatary systems, they can reach out to me with an offer. 😉

genesio-Ka commented 10 months ago

Sorry, I also have Sonoma MacOS 14.2.1 not 14.2.2. You can try to run the tutorial data in mirdeep-2.0.1.3

From: Marcel Schilling @.> Sent: Friday, January 12, 2024 12:02 PM To: rajewsky-lab/mirdeep2 @.> Cc: Genesio Mugambi Karere @.>; Author @.> Subject: [EXTERNAL] Re: [rajewsky-lab/mirdeep2] mirdeep2 is not generating arf files (Issue #118)

WARNING: This email originated from outside of Advocate Health @.***). DO NOT click links or open attachments unless you know and trust the sender. NEVER provide your login information to anyone. USE Squish the Phish to report suspicious email.

I do have access to a MacBook running Sonoma 14.2.1. @Drmirdeep [github.com]https://urldefense.com/v3/__https://github.com/Drmirdeep__;!!GA8Xfdg!15KhjK_brDF0BowByez15Dvq6Pnb-ouKAqUV2YCrTp98Q3LM_vHXYU2pzuAc-lA9m2rgsUJ2-OQ0bvrCKPabtTPeng$: If you want, I could try to reproduce this issue on that system. Version 14.2.2 is not (yet) available for that system, so upgrading to the exact same OS version is not an option at this time.

— Reply to this email directly, view it on GitHub [github.com]https://urldefense.com/v3/__https://github.com/rajewsky-lab/mirdeep2/issues/118*issuecomment-1889654769__;Iw!!GA8Xfdg!15KhjK_brDF0BowByez15Dvq6Pnb-ouKAqUV2YCrTp98Q3LM_vHXYU2pzuAc-lA9m2rgsUJ2-OQ0bvrCKPY-H0NiPw$, or unsubscribe [github.com]https://urldefense.com/v3/__https://github.com/notifications/unsubscribe-auth/BFGN4QBQVBWTHVNUU2WAH7LYOFUD7AVCNFSM6AAAAABBVQW54WVHI2DSMVQWIX3LMV43OSLTON2WKQ3PNVWWK3TUHMYTQOBZGY2TINZWHE__;!!GA8Xfdg!15KhjK_brDF0BowByez15Dvq6Pnb-ouKAqUV2YCrTp98Q3LM_vHXYU2pzuAc-lA9m2rgsUJ2-OQ0bvrCKPbqU6OO0w$. You are receiving this because you authored the thread.Message ID: @.***>

This electronic message is intended only for the use of the individual(s) and entity named as recipients in the message. If you are not an intended recipient of this message, please notify the sender immediately and delete the material from any computer. Do not deliver, distribute or copy this message, and do not disclose its contents or take any action in reliance on the information it contains. Thank you.

genesio-Ka commented 10 months ago

Hello, Were you successful in running mirdeep2 on your mac?

I am still having the same problem: arf file is empty

I also get this message: grep: /proc/cpuinfo: No such file or directory

From: Genesio Mugambi Karere @.> Sent: Friday, January 12, 2024 12:52 PM To: rajewsky-lab/mirdeep2 @.>; rajewsky-lab/mirdeep2 @.> Cc: Author @.> Subject: Re: [EXTERNAL] Re: [rajewsky-lab/mirdeep2] mirdeep2 is not generating arf files (Issue #118)

Sorry, I also have Sonoma MacOS 14.2.1 not 14.2.2. You can try to run the tutorial data in mirdeep-2.0.1.3

From: Marcel Schilling @.> Sent: Friday, January 12, 2024 12:02 PM To: rajewsky-lab/mirdeep2 @.> Cc: Genesio Mugambi Karere @.>; Author @.> Subject: [EXTERNAL] Re: [rajewsky-lab/mirdeep2] mirdeep2 is not generating arf files (Issue #118)

WARNING: This email originated from outside of Advocate Health @.***). DO NOT click links or open attachments unless you know and trust the sender. NEVER provide your login information to anyone. USE Squish the Phish to report suspicious email.

I do have access to a MacBook running Sonoma 14.2.1. @Drmirdeep [github.com]https://urldefense.com/v3/__https://github.com/Drmirdeep__;!!GA8Xfdg!15KhjK_brDF0BowByez15Dvq6Pnb-ouKAqUV2YCrTp98Q3LM_vHXYU2pzuAc-lA9m2rgsUJ2-OQ0bvrCKPabtTPeng$: If you want, I could try to reproduce this issue on that system. Version 14.2.2 is not (yet) available for that system, so upgrading to the exact same OS version is not an option at this time.

— Reply to this email directly, view it on GitHub [github.com]https://urldefense.com/v3/__https://github.com/rajewsky-lab/mirdeep2/issues/118*issuecomment-1889654769__;Iw!!GA8Xfdg!15KhjK_brDF0BowByez15Dvq6Pnb-ouKAqUV2YCrTp98Q3LM_vHXYU2pzuAc-lA9m2rgsUJ2-OQ0bvrCKPY-H0NiPw$, or unsubscribe [github.com]https://urldefense.com/v3/__https://github.com/notifications/unsubscribe-auth/BFGN4QBQVBWTHVNUU2WAH7LYOFUD7AVCNFSM6AAAAABBVQW54WVHI2DSMVQWIX3LMV43OSLTON2WKQ3PNVWWK3TUHMYTQOBZGY2TINZWHE__;!!GA8Xfdg!15KhjK_brDF0BowByez15Dvq6Pnb-ouKAqUV2YCrTp98Q3LM_vHXYU2pzuAc-lA9m2rgsUJ2-OQ0bvrCKPbqU6OO0w$. You are receiving this because you authored the thread.Message ID: @.***>

This electronic message is intended only for the use of the individual(s) and entity named as recipients in the message. If you are not an intended recipient of this message, please notify the sender immediately and delete the material from any computer. Do not deliver, distribute or copy this message, and do not disclose its contents or take any action in reliance on the information it contains. Thank you.

genesio-Ka commented 10 months ago

Hello, Were you successful in running mirdeep2 on your mac?

I am still having the same problem: arf file is empty

I also get these messages:

grep: /proc/cpuinfo: No such file or directory

env: python: No such file or directory

From: Genesio Mugambi Karere @.> Sent: Saturday, January 20, 2024 11:51 PM To: rajewsky-lab/mirdeep2 @.>; rajewsky-lab/mirdeep2 @.> Cc: Author @.> Subject: Re: [EXTERNAL] Re: [rajewsky-lab/mirdeep2] mirdeep2 is not generating arf files (Issue #118)

Hello, Were you successful in running mirdeep2 on your mac?

I am still having the same problem: arf file is empty

I also get this message: grep: /proc/cpuinfo: No such file or directory

From: Genesio Mugambi Karere @.> Sent: Friday, January 12, 2024 12:52 PM To: rajewsky-lab/mirdeep2 @.>; rajewsky-lab/mirdeep2 @.> Cc: Author @.> Subject: Re: [EXTERNAL] Re: [rajewsky-lab/mirdeep2] mirdeep2 is not generating arf files (Issue #118)

Sorry, I also have Sonoma MacOS 14.2.1 not 14.2.2. You can try to run the tutorial data in mirdeep-2.0.1.3

From: Marcel Schilling @.> Sent: Friday, January 12, 2024 12:02 PM To: rajewsky-lab/mirdeep2 @.> Cc: Genesio Mugambi Karere @.>; Author @.> Subject: [EXTERNAL] Re: [rajewsky-lab/mirdeep2] mirdeep2 is not generating arf files (Issue #118)

WARNING: This email originated from outside of Advocate Health @.***). DO NOT click links or open attachments unless you know and trust the sender. NEVER provide your login information to anyone. USE Squish the Phish to report suspicious email.

I do have access to a MacBook running Sonoma 14.2.1. @Drmirdeep [github.com]https://urldefense.com/v3/__https://github.com/Drmirdeep__;!!GA8Xfdg!15KhjK_brDF0BowByez15Dvq6Pnb-ouKAqUV2YCrTp98Q3LM_vHXYU2pzuAc-lA9m2rgsUJ2-OQ0bvrCKPabtTPeng$: If you want, I could try to reproduce this issue on that system. Version 14.2.2 is not (yet) available for that system, so upgrading to the exact same OS version is not an option at this time.

— Reply to this email directly, view it on GitHub [github.com]https://urldefense.com/v3/__https://github.com/rajewsky-lab/mirdeep2/issues/118*issuecomment-1889654769__;Iw!!GA8Xfdg!15KhjK_brDF0BowByez15Dvq6Pnb-ouKAqUV2YCrTp98Q3LM_vHXYU2pzuAc-lA9m2rgsUJ2-OQ0bvrCKPY-H0NiPw$, or unsubscribe [github.com]https://urldefense.com/v3/__https://github.com/notifications/unsubscribe-auth/BFGN4QBQVBWTHVNUU2WAH7LYOFUD7AVCNFSM6AAAAABBVQW54WVHI2DSMVQWIX3LMV43OSLTON2WKQ3PNVWWK3TUHMYTQOBZGY2TINZWHE__;!!GA8Xfdg!15KhjK_brDF0BowByez15Dvq6Pnb-ouKAqUV2YCrTp98Q3LM_vHXYU2pzuAc-lA9m2rgsUJ2-OQ0bvrCKPbqU6OO0w$. You are receiving this because you authored the thread.Message ID: @.***>

This electronic message is intended only for the use of the individual(s) and entity named as recipients in the message. If you are not an intended recipient of this message, please notify the sender immediately and delete the material from any computer. Do not deliver, distribute or copy this message, and do not disclose its contents or take any action in reliance on the information it contains. Thank you.

mschilli87 commented 10 months ago

@genesio-Ka: I did not attempt to do so as I am waiting for @Drmirdeep to ask me to do so. I would do that as a personal favor to them if they wanted to. Like I said I do not do free work to support non-free operating systems and I do not appreciate being pushed to do so. Did you try running miRDeep2 on a Linux system? Do you get the same problem there?

genesio-Ka commented 10 months ago

We are setting up to use Linux. I will let you know. Thanks

From: Marcel Schilling @.> Sent: Sunday, January 21, 2024 4:47 AM To: rajewsky-lab/mirdeep2 @.> Cc: Genesio Mugambi Karere @.>; Mention @.> Subject: [EXTERNAL] Re: [rajewsky-lab/mirdeep2] mirdeep2 is not generating arf files (Issue #118)

WARNING: This email originated from outside of Advocate Health @.***). DO NOT click links or open attachments unless you know and trust the sender. NEVER provide your login information to anyone. USE Squish the Phish to report suspicious email.

@genesio-Ka [github.com]https://urldefense.com/v3/__https://github.com/genesio-Ka__;!!GA8Xfdg!xw9e8n9hHZRQDmoXg-8G0M6q2lGfEDf27tFDyfv5bD7OG-cHYWGljxOUNsqz2XSJf8PGmq8hFeI8C2WThGpT-iOtuQ$: I did not attempt to do so as I am waiting for @Drmirdeep [github.com]https://urldefense.com/v3/__https://github.com/Drmirdeep__;!!GA8Xfdg!xw9e8n9hHZRQDmoXg-8G0M6q2lGfEDf27tFDyfv5bD7OG-cHYWGljxOUNsqz2XSJf8PGmq8hFeI8C2WThGpR7vGzjw$ to ask me to do so. I would do that as a personal favor to them if they wanted to. Like I said I do not do free work tp support non-free operating systems and I do not appreciate being pushed to do so. Did you try running miRDeep2 on a Linux system? Do you get the same problem there?

— Reply to this email directly, view it on GitHub [github.com]https://urldefense.com/v3/__https://github.com/rajewsky-lab/mirdeep2/issues/118*issuecomment-1902572407__;Iw!!GA8Xfdg!xw9e8n9hHZRQDmoXg-8G0M6q2lGfEDf27tFDyfv5bD7OG-cHYWGljxOUNsqz2XSJf8PGmq8hFeI8C2WThGrY5M17Hw$, or unsubscribe [github.com]https://urldefense.com/v3/__https://github.com/notifications/unsubscribe-auth/BFGN4QCQVOWSUNBNOHHPC6TYPTP37AVCNFSM6AAAAABBVQW54WVHI2DSMVQWIX3LMV43OSLTON2WKQ3PNVWWK3TUHMYTSMBSGU3TENBQG4__;!!GA8Xfdg!xw9e8n9hHZRQDmoXg-8G0M6q2lGfEDf27tFDyfv5bD7OG-cHYWGljxOUNsqz2XSJf8PGmq8hFeI8C2WThGrsRKSDgA$. You are receiving this because you were mentioned.Message ID: @.***>

This electronic message is intended only for the use of the individual(s) and entity named as recipients in the message. If you are not an intended recipient of this message, please notify the sender immediately and delete the material from any computer. Do not deliver, distribute or copy this message, and do not disclose its contents or take any action in reliance on the information it contains. Thank you.

genesio-Ka commented 9 months ago

1.We successfully installed mirdeep2 in Linux machine (Franklin server).

2.Ran the mapper.pl successfully and obtained miRNA_reads_Trim4.fa file and miRNA_reads_vs_hg19_Trim4.arf file without any error message.

3.Tried to perform quantification using mirdeep2.pl with this script:./miRDeep2.pl miRNA_reads_Trim4.fa /home/genome/hg19.fa miRNA_reads_vs_hg19_Trim4.arf /home/hsa_22_mature_true.fa /home/all_22_mature_true.fa /home/hsa_22_hairpin_true.fa -t human 2 > report.log

We then got this error message:

sanity_check_reads_ready_file.pl pepper_somma_study_human_miRNA_reads_Trim4.fa

started: 18:18:54

Error: problem with miRNA_reads_Trim4.fa

Error in line 1.921.221: Either the sequence contains less than 17 characters or contains characters others than [acgtunACGTUN]

Please make sure that your file only comprises sequences that have at least 17 characters containing letters [acgtunACGTUN]

We checked the miRNA_reads_Trim4.fa file for unacceptable characters and sequence length. We did not find any sequence with any other characters rather than ACGTUN. We found multiple sequences with "N" which is acceptable. None had "U". All sequences are between 21 and 26 bp.

Please let me know if you have any suggestions/comments.

Thanks

From: Genesio Mugambi Karere @.> Sent: Tuesday, January 23, 2024 11:20 AM To: rajewsky-lab/mirdeep2 @.>; rajewsky-lab/mirdeep2 @.> Cc: Mention @.> Subject: Re: [EXTERNAL] Re: [rajewsky-lab/mirdeep2] mirdeep2 is not generating arf files (Issue #118)

We are setting up to use Linux. I will let you know. Thanks

From: Marcel Schilling @.> Sent: Sunday, January 21, 2024 4:47 AM To: rajewsky-lab/mirdeep2 @.> Cc: Genesio Mugambi Karere @.>; Mention @.> Subject: [EXTERNAL] Re: [rajewsky-lab/mirdeep2] mirdeep2 is not generating arf files (Issue #118)

WARNING: This email originated from outside of Advocate Health @.***). DO NOT click links or open attachments unless you know and trust the sender. NEVER provide your login information to anyone. USE Squish the Phish to report suspicious email.

@genesio-Ka [github.com]https://urldefense.com/v3/__https://github.com/genesio-Ka__;!!GA8Xfdg!xw9e8n9hHZRQDmoXg-8G0M6q2lGfEDf27tFDyfv5bD7OG-cHYWGljxOUNsqz2XSJf8PGmq8hFeI8C2WThGpT-iOtuQ$: I did not attempt to do so as I am waiting for @Drmirdeep [github.com]https://urldefense.com/v3/__https://github.com/Drmirdeep__;!!GA8Xfdg!xw9e8n9hHZRQDmoXg-8G0M6q2lGfEDf27tFDyfv5bD7OG-cHYWGljxOUNsqz2XSJf8PGmq8hFeI8C2WThGpR7vGzjw$ to ask me to do so. I would do that as a personal favor to them if they wanted to. Like I said I do not do free work tp support non-free operating systems and I do not appreciate being pushed to do so. Did you try running miRDeep2 on a Linux system? Do you get the same problem there?

— Reply to this email directly, view it on GitHub [github.com]https://urldefense.com/v3/__https://github.com/rajewsky-lab/mirdeep2/issues/118*issuecomment-1902572407__;Iw!!GA8Xfdg!xw9e8n9hHZRQDmoXg-8G0M6q2lGfEDf27tFDyfv5bD7OG-cHYWGljxOUNsqz2XSJf8PGmq8hFeI8C2WThGrY5M17Hw$, or unsubscribe [github.com]https://urldefense.com/v3/__https://github.com/notifications/unsubscribe-auth/BFGN4QCQVOWSUNBNOHHPC6TYPTP37AVCNFSM6AAAAABBVQW54WVHI2DSMVQWIX3LMV43OSLTON2WKQ3PNVWWK3TUHMYTSMBSGU3TENBQG4__;!!GA8Xfdg!xw9e8n9hHZRQDmoXg-8G0M6q2lGfEDf27tFDyfv5bD7OG-cHYWGljxOUNsqz2XSJf8PGmq8hFeI8C2WThGrsRKSDgA$. You are receiving this because you were mentioned.Message ID: @.***>

This electronic message is intended only for the use of the individual(s) and entity named as recipients in the message. If you are not an intended recipient of this message, please notify the sender immediately and delete the material from any computer. Do not deliver, distribute or copy this message, and do not disclose its contents or take any action in reliance on the information it contains. Thank you.

mschilli87 commented 9 months ago

@Drmirdeep: Any idea what could be going wrong?

@genesio-Ka: Could you try reproducing the error with a subset of your data? For example, does it work if you only use the first 100 lines? Or only ten sequences that do not contain anything but ACGT? If so, can you make it fail by adding one of your sequences containing an N? Try small subsets of your data to see if you can find a pattern. Ideally, this will lead you to identify a specific sequence that triggers the issue which you could share here for us to reproduce and investigate the error.

Drmirdeep commented 7 months ago

could you paste here please the output of head -n 1921218 pepper_somma_study_human_miRNA_reads_Trim4.fa | tail -n 6

Drmirdeep commented 7 months ago

One of the problems seems to be that bowtie is a python2 wrapper script in version 1.1.1 using env python to detect it. So one problem maybe not having env installed or not having python2 on the system.

Easiest is likely to install bowtie manually and put its binary directory into the PATH

Drmirdeep commented 6 months ago

I close this for now. So far each of these errors could be traced back anyways to something unrelated to the software package but instead ‘faulty’ data

genesio-Ka commented 6 months ago

Thanks. I think the problem was due to the computing environment. I switched my human data analysis from Mac Computer (OS Sonoma 14.3.1) to LINUX (Franklin server) and that solved the problem.

From: Sebastian Mackowiak @.> Sent: Saturday, June 1, 2024 3:14 PM To: rajewsky-lab/mirdeep2 @.> Cc: Genesio Mugambi Karere @.>; Mention @.> Subject: [EXTERNAL] Re: [rajewsky-lab/mirdeep2] mirdeep2 is not generating arf files (Issue #118)

WARNING: This email originated from outside of Advocate Health @.***). DO NOT click links or open attachments unless you know and trust the sender. NEVER provide your login information to anyone. USE Squish the Phish to report suspicious email.

Closed #118https://urldefense.com/v3/__https://github.com/rajewsky-lab/mirdeep2/issues/118__;!!GA8Xfdg!0jNv0JQsOnj8zE-W6AJL_T6TVDEQd8KTb9xjQxqMTka4w-fJkZI_yeSxAxXbxzlInexiH65j4ortvrIKNM6ss91F9Q$ as completed.

— Reply to this email directly, view it on GitHubhttps://urldefense.com/v3/__https://github.com/rajewsky-lab/mirdeep2/issues/118*event-13009948556__;Iw!!GA8Xfdg!0jNv0JQsOnj8zE-W6AJL_T6TVDEQd8KTb9xjQxqMTka4w-fJkZI_yeSxAxXbxzlInexiH65j4ortvrIKNM53RFNfDw$, or unsubscribehttps://urldefense.com/v3/__https://github.com/notifications/unsubscribe-auth/BFGN4QEFMPOYZPX67YBFCXLZFIMQLAVCNFSM6AAAAABBVQW54WVHI2DSMVQWIX3LMV45UABCJFZXG5LFIV3GK3TUJZXXI2LGNFRWC5DJN5XDWMJTGAYDSOJUHA2TKNQ__;!!GA8Xfdg!0jNv0JQsOnj8zE-W6AJL_T6TVDEQd8KTb9xjQxqMTka4w-fJkZI_yeSxAxXbxzlInexiH65j4ortvrIKNM72OtAWYA$. You are receiving this because you were mentioned.Message ID: @.***>

This electronic message is intended only for the use of the individual(s) and entity named as recipients in the message. If you are not an intended recipient of this message, please notify the sender immediately and delete the material from any computer. Do not deliver, distribute or copy this message, and do not disclose its contents or take any action in reliance on the information it contains. Thank you.