search

refresh-bio / DSRC

DSRC - DNA Sequence Reads Compressor
http://sun.aei.polsl.pl/dsrc/
55 stars 19 forks source link

DSRC nonfunctional in Windows #14

Open bbushnell opened 8 years ago

bbushnell commented 8 years ago

I'm running Windows 7 64-bit. I can execute dsrc with no arguments, and it prints usage information. But if I tell it to do something, it crashes:

C:\temp\ecoli>dsrc c readx.fq readx.dsrc

...a window pops up, "dsrc.exe has stopped working"

For reference, this was the input:

@0_chr1_0_407422_407571_399422_ecoli GATGCAGGTCAGCATTGCTTTTGCCGAACAGCATACCAAAGGGTATCCGTGGAAAATGGACGGTACAGTCCGTCAGGAAGTCTTCAGTCGCCGCGGCGGATTGTGGTTTGGTACTTACCATTTACTGAATTATCCCGCCAGTTATAGCGC + ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????

jvolkening commented 8 years ago

Have you tried a test file with more than one record? See issue #13 for a problem I noticed with single-record inputs, but that was on Linux so not a Windows-specific issue.

lrog commented 8 years ago

Could you please try now to re-compile the code from the fresh devel branch and re-run on your example? I've merged the fix from @jvolkening to devel branch for this case with slight modification in 485316eaef971fcb46603b62ae4df3df1d707b84 .