Closed sklages closed 6 years ago
Hi,
I compiled skewer wihout any issues on our home-made linux system.
Running skewer then on two 55GB fastq files results in a segfault after a few seconds.
skewer -m mp -i mpg_L4499-4_MySuperProjectXXX_AGTCAA_L002_R1_001.fastq mpg_L4499-4_MySuperProjectXXX_AGTCAA_L002_R2_001.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- junction adapter sequence (-j): CTGTCTCTTATACACATCTAGATGTGTATAAGAGACAG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ (auto detected) -- minimum overlap length for junction adapter detection (-k): 0 -- redistribute reads based on junction information (-i): yes Fri Jun 12 11:06:47 2015 >> started |> | (0.02%)Segmentation fault
Omitting the second fastq file does not result in a segfault.
This is 256GB / 48 core machines. Ressources should suffice .. any idea?
best, Sven
Could you send me part of the data that cause this segmentation fault?
Hi,
I compiled skewer wihout any issues on our home-made linux system.
Running skewer then on two 55GB fastq files results in a segfault after a few seconds.
Omitting the second fastq file does not result in a segfault.
This is 256GB / 48 core machines. Ressources should suffice .. any idea?
best, Sven