search

rki-mf1 / amplisim

Plain simple amplicon sequence simulator for in-silico genomic sequencing assays
Apache License 2.0
2 stars 0 forks source link

AmpliconGenerator throws an std::out_of_range error if a primer range is outside reference sequence length #13

Open Krannich479 opened 12 months ago

Krannich479 commented 12 months ago

Situation:

If a primer region e.g.

MyRef    23000    23031    my_primer_name    1    +    ACCAGCGATCGACGGAGCTAGATCGATCGAT

comes after a reference seq length, e.g. 5000, amplisim aborts with a runtime error from the compiler.

Todo:

Catch this case and improve error handling.