search

rkweku / miRador

Plant miRNA identification tool that utilizes a variety of filters to validate predicted miRNAs
GNU General Public License v3.0
5 stars 2 forks source link

ERROR: sequence and structure have unequal length #3

Open aijigekoukou-shen opened 3 years ago

aijigekoukou-shen commented 3 years ago

Hi When I use miRador, I get the following error report，like this

2021-05-20 09:44:42,936 - miRador - miRador - Time to filter inverted repeats: 0.48 seconds 2021-05-20 09:44:42,940 - miRador - miRador - Annotating candidate miRNAs 2021-05-20 09:44:42,978 - miRador - miRador - Running sequence alignment in parallel ERROR: sequence and structure have unequal length readline() on closed filehandle PS at drawPrecursor/drawPrecursor.pl line 118. ERROR: sequence and structure have unequal length readline() on closed filehandle PS at drawPrecursor/drawPrecursor.pl line 118.

And What should I do now?

rkweku commented 3 years ago

This is an error when trying to draw the miRNA:miRNA* duplex on the precursor miRNA using RNAFold. I've seen this type of issue before, but I cannot recall the exact cause. I think the issue is less a problem with the drawPrecursor function though and may actually be an issue with incomplete results in preAnnotatedCandidates file resulting in the mirSeq and starSeq not being complete. Could you check that file to confirm there are actually results in this file?

aijigekoukou-shen commented 3 years ago

I checked the result file, they are finalAnnotatedCandidates.csv finalAnnotatedCandidates.fa preAnnotatedCandidates.csv and preAnnotatedCandidates.fa. and here is a brief description of these documents:

head finalAnnotatedCandidates.csv miR Name,Chr,Strand,miR Position,miR Sequence,miR Hits,miR Length,Star Position,Star Sequence,Star Hits,Star Length,miR Abun in RT1.Clean,Star Abun in RT1.Clean,1-nt Variants miR Abun in RT1.Clean,1-nt Variants Star Abun in RT1.Clean,Total Precursor Abun in RT1.Clean,Proportion of reads from miR:miR in RT1.Clean,miR Abun in RT2.Clean,Star Abun in RT2.Clean,1-nt Variants miR Abun in RT2.Clean,1-nt Variants Star Abun in RT2.Clean,Total Precursor Abun in RT2.Clean,Proportion of reads from miR:miR in RT2.Clean,miR Abun in ST1.Clean,Star Abun in ST1.Clean,1-nt Variants miR Abun in ST1.Clean,1-nt Variants Star Abun in ST1.Clean,Total Precursor Abun in ST1.Clean,Proportion of reads from miR:miR in ST1.Clean,miR Abun in ST2.Clean,Star Abun in ST2.Clean,1-nt Variants miR Abun in ST2.Clean,1-nt Variants Star Abun in ST2.Clean,Total Precursor Abun in ST2.Clean,Proportion of reads from miR:miR in ST2.Clean,Classification Flag candidate-21994-3p,Chr01,w,21070009,AUGUGUUGAGCAGAGGAAUUC,1,21,21069791,AUUCCUCCUGCCCAACACAUGG,1,22,3.3924179458909336,0.30840163144463034,3.3924179458909336,0.6168032628892607,4.009221208780194,1.0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,Novel candidate-22637-5p,Chr01,c,21718282,UCCAUGGAAGAUAAUGACUCG,5,21,21718370,AGCUAUUGUCUUCCAUGGAAU,5,21,6.414753934048311,0.06168032628892607,6.846516218070794,0.06168032628892607,8.799726550553453,0.7850467289719626,3.263735152554849,0.11656196973410175,3.5551400768901034,0.11656196973410175,4.351646870073132,0.84375,0,0,0,0,0,0,0,0,0,0,0,0,Conserved family of the following:,miR6425,ptc

head finalAnnotatedCandidates.fa

candidate-21994-3p AUGUGUUGAGCAGAGGAAUUC candidate-22637-5p UCCAUGGAAGAUAAUGACUCG candidate-22643-5p UCCAUGGAAGAUAAUGACUCG candidate-22645-5p UCCAUGGAAGAUAAUGACUCG candidate-22651-5p UCCAUGGAAGAUAAUGACUCG

head preAnnotatedCandidates.csv miR Name,Chr,Strand,miR Position,miR Sequence,miR Hits,miR Length,Star Position,Star Sequence,Star Hits,Star Length,miR Abun in RT1.Clean,Star Abun in RT1.Clean,1-nt Variants miR Abun in RT1.Clean,1-nt Variants Star Abun in RT1.Clean,Total Precursor Abun in RT1.Clean,Proportion of reads from miR:miR in RT1.Clean,miR Abun in RT2.Clean,Star Abun in RT2.Clean,1-nt Variants miR Abun in RT2.Clean,1-nt Variants Star Abun in RT2.Clean,Total Precursor Abun in RT2.Clean,Proportion of reads from miR:miR in RT2.Clean,miR Abun in ST1.Clean,Star Abun in ST1.Clean,1-nt Variants miR Abun in ST1.Clean,1-nt Variants Star Abun in ST1.Clean,Total Precursor Abun in ST1.Clean,Proportion of reads from miR:miR in ST1.Clean,miR Abun in ST2.Clean,Star Abun in ST2.Clean,1-nt Variants miR Abun in ST2.Clean,1-nt Variants Star Abun in ST2.Clean,Total Precursor Abun in ST2.Clean,Proportion of reads from miR:miR in ST2.Clean candidate-21994-3p,Chr01,w,21070009,AUGUGUUGAGCAGAGGAAUUC,1,21,21069791,AUUCCUCCUGCCCAACACAUGG,1,22,3.3924179458909336,0.30840163144463034,3.3924179458909336,0.6168032628892607,4.009221208780194,1.0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0 candidate-22637-5p,Chr01,c,21718282,UCCAUGGAAGAUAAUGACUCG,5,21,21718370,AGCUAUUGUCUUCCAUGGAAU,5,21,6.414753934048311,0.06168032628892607,6.846516218070794,0.06168032628892607,8.799726550553453,0.7850467289719626,3.263735152554849,0.11656196973410175,3.5551400768901034,0.11656196973410175,4.351646870073132,0.84375,0,0,0,0,0,0,0,0,0,0,0,0

head preAnnotatedCandidates.fa

candidate-21994-3p AUGUGUUGAGCAGAGGAAUUC candidate-22637-5p UCCAUGGAAGAUAAUGACUCG candidate-22643-5p UCCAUGGAAGAUAAUGACUCG candidate-22645-5p UCCAUGGAAGAUAAUGACUCG candidate-22651-5p UCCAUGGAAGAUAAUGACUCG

Would you mind telling me the contents of the document are correct? In addition, my reference species is Ath.