search

ropensci / babette

babette is an R package to work with BEAST2
https://docs.ropensci.org/babette
GNU General Public License v3.0
44 stars 6 forks source link

babette Issue that fails on Mac, passes on Peregrine #69

Closed richelbilderbeek closed 5 years ago

richelbilderbeek commented 5 years ago

On 26 August 2019 at 15:41:07 +02:00, Janzen, T. wrote

Lokaal krijg ik de volgende error:

[... eerdere code van de functie 'infer_phylogeny'] 

beast2_options <- beastier::create_beast2_options()

if(peregrine::is_on_peregrine()) {
    beast2_options <- peregrine::create_pff_beast2_options()
}

posterior <- babette::bbt_run_from_model(
    fasta_filename = temp_file_name,
    inference_model = inference_model,
    beast2_options = beast2_options
 )

ERROR:

Error in check_input_filename_validity(input_filename = input_filename,  :
  'input_filename' must be a valid BEAST2 XML file. File '/var/folders/cz/dwggddxj7vs06byvsw1sh90w0000gp/T//Rtmpbvgesr/file1768e6b8ac4cc.xml' is not a valid BEAST2 file. FALSE
In addition: Warning messages:
1: In system2(cmds[1], args = cmds[-1], stdout = TRUE, stderr = TRUE) :
  running command ''/Library/Java/JavaVirtualMachines/jdk1.8.0_202.jdk/Contents/Home/jre/bin/java' -jar "/Users/janzen/Library/Application Support/BEAST/lib/launcher.jar" -validate "/var/folders/cz/dwggddxj7vs06byvsw1sh90w0000gp/T//Rtmpbvgesr/file1768e6b8ac4cc.xml" 2>&1' had status 1
2: In system2(cmds[1], args = cmds[-1], stdout = TRUE, stderr = TRUE) :
  running command ''/Library/Java/JavaVirtualMachines/jdk1.8.0_202.jdk/Contents/Home/jre/bin/java' -jar "/Users/janzen/Library/Application Support/BEAST/lib/launcher.jar" -validate "/var/folders/cz/dwggddxj7vs06byvsw1sh90w0000gp/T//Rtmpbvgesr/file1768e6b8ac4cc.xml" 2>&1' had status 1

Er gaat dus iets fout met de input_filename - ik heb geen idee waar die file vandaan komt, dat is een intern babette dingetje vermoed ik ;)

On Mon, Aug 26, 2019 at 4:17 PM Richel Bilderbeek wrote

Ik heb die fout ook soms lokaal! Ik denk zelf dat het een Java dingetje is. Mijn vragen zijn:

1) Werkt deze code lokaal na deze update:

remotes::install_github("ropensci/babette", ref = "develop"

2) Zo nee,  werkt dit:

babette::bbt_run_from_model(
  fasta_filename = beautier::get_fasta_filename()
)

Overigens, het idee van babette is dat je de BEAST2 options niet hoeft te specificeren dat alles achter de schermen goed gaat.

3) Zo nee, welke site model, clock model en tree prior gebruik je? Werkt jouw code wel op Peregrine?

On 26 August 2019 at 16:21:32 +02:00, Janzen, T. wrote

1) nee

Error in check_input_filename_validity(input_filename = input_filename,  :
  'input_filename' must be a valid BEAST2 XML file. File '/var/folders/cz/dwggddxj7vs06byvsw1sh90w0000gp/T//RtmpYGsnoY/file1780760bb6bae.xml' is not a valid BEAST2 file. FALSE

2) nee: 

Error in check_input_filename_validity(input_filename = input_filename,  :
  'input_filename' must be a valid BEAST2 XML file. File '/var/folders/cz/dwggddxj7vs06byvsw1sh90w0000gp/T//RtmpYGsnoY/file178076db08dd4.xml' is not a valid BEAST2 file. FALSE

3) 

inference_model = beautier::create_inference_model(
                                         site_model = beautier::create_jc69_site_model(),
                                         clock_model = beautier::create_strict_clock_model(),
                                         tree_prior = beautier::create_yule_tree_prior(),
                                         mcmc = beautier::create_mcmc(chain_length = 1e6,
                                                                      store_every = 5000))

Op Peregrine werkt het wel, gek genoeg. Dat scheelt al de helft ;)

richelbilderbeek commented 5 years ago

Hmmm, wat doet het onderstaande en is er een bestand 'for_richel.xml' dat je mij kunt sturen? 

inference_model <- beautier::create_inference_model(
  site_model = beautier::create_jc69_site_model(),
  clock_model = beautier::create_strict_clock_model(),
  tree_prior = beautier::create_yule_tree_prior(),
  mcmc = beautier::create_mcmc(chain_length = 3e3, store_every = 1000)
)

babette::bbt_run_from_model(
  fasta_filename = beautier::get_fasta_filename(),
  inference_model = inference_model,
  beast2_options = beastier::create_beast2_options(
    input_filename = "for_richel.xml",
    verbose = TRUE
  )
)
richelbilderbeek commented 5 years ago

Ha! Het werkt niet, maar er is wel een xml file (zie attachment) Error msg:

[1] "input_filename: for_richel.xml"
[1] "output_log_filename: /var/folders/cz/dwggddxj7vs06byvsw1sh90w0000gp/T//RtmpYfRcOe/file2d25e5af129.log"
[1] "output_trees_filenames: /var/folders/cz/dwggddxj7vs06byvsw1sh90w0000gp/T//RtmpYfRcOe/file2d2248eeb24.trees"
[1] "output_state_filename: /var/folders/cz/dwggddxj7vs06byvsw1sh90w0000gp/T//RtmpYfRcOe/file2d222ef9b3c.xml.state"
Error in check_input_filename_validity(input_filename = input_filename,  :
  'input_filename' must be a valid BEAST2 XML file. File '/Users/janzen/MEGAsync/GitHub/nodeSub/for_richel.xml' is not a valid BEAST2 file. FALSE
In addition: Warning messages:
1: In system2(cmds[1], args = cmds[-1], stdout = TRUE, stderr = TRUE) :
  running command ''/Library/Java/JavaVirtualMachines/jdk1.8.0_202.jdk/Contents/Home/jre/bin/java' -jar "/Users/janzen/Library/Application Support/BEAST/lib/launcher.jar" -validate "/Users/janzen/MEGAsync/GitHub/nodeSub/for_richel.xml" 2>&1' had status 1
2: In system2(cmds[1], args = cmds[-1], stdout = TRUE, stderr = TRUE) :
  running command ''/Library/Java/JavaVirtualMachines/jdk1.8.0_202.jdk/Contents/Home/jre/bin/java' -jar "/Users/janzen/Library/Application Support/BEAST/lib/launcher.jar" -validate "/Users/janzen/MEGAsync/GitHub/nodeSub/for_richel.xml" 2>&1' had status 1

for_richel.zip

Or here:

<?xml version="1.0" encoding="UTF-8" standalone="no"?><beast beautitemplate='Standard' beautistatus='' namespace="beast.core:beast.evolution.alignment:beast.evolution.tree.coalescent:beast.core.util:beast.evolution.nuc:beast.evolution.operators:beast.evolution.sitemodel:beast.evolution.substitutionmodel:beast.evolution.likelihood" required="" version="2.4">

    <data
id="test_output_0"
name="alignment">
                    <sequence id="seq_t1" taxon="t1" totalcount="4" value="acttgttgcgactgcgcctg"/>
                    <sequence id="seq_t2" taxon="t2" totalcount="4" value="acttattgcgactgaggccg"/>
                    <sequence id="seq_t3" taxon="t3" totalcount="4" value="acttaatgcgaatgagcccg"/>
                    <sequence id="seq_t4" taxon="t4" totalcount="4" value="aacgacccgcgatcggggat"/>
                    <sequence id="seq_t5" taxon="t5" totalcount="4" value="acttgttgcgactgagcctg"/>
                </data>

<map name="Uniform" >beast.math.distributions.Uniform</map>
<map name="Exponential" >beast.math.distributions.Exponential</map>
<map name="LogNormal" >beast.math.distributions.LogNormalDistributionModel</map>
<map name="Normal" >beast.math.distributions.Normal</map>
<map name="Beta" >beast.math.distributions.Beta</map>
<map name="Gamma" >beast.math.distributions.Gamma</map>
<map name="LaplaceDistribution" >beast.math.distributions.LaplaceDistribution</map>
<map name="prior" >beast.math.distributions.Prior</map>
<map name="InverseGamma" >beast.math.distributions.InverseGamma</map>
<map name="OneOnX" >beast.math.distributions.OneOnX</map>

<run id="mcmc" spec="MCMC" chainLength="3000" storeEvery="1000">
    <state id="state" storeEvery="5000">
        <tree id="Tree.t:test_output_0" name="stateNode">
            <taxonset id="TaxonSet.test_output_0" spec="TaxonSet">
                <alignment idref="test_output_0"/>
            </taxonset>
        </tree>
        <parameter id="birthRate.t:test_output_0" name="stateNode">1.0</parameter>
    </state>

    <init id="RandomTree.t:test_output_0" spec="beast.evolution.tree.RandomTree" estimate="false" initial="@Tree.t:test_output_0" taxa="@test_output_0">
        <populationModel id="ConstantPopulation0.t:test_output_0" spec="ConstantPopulation">
            <parameter id="randomPopSize.t:test_output_0" name="popSize">1.0</parameter>
        </populationModel>
    </init>

    <distribution id="posterior" spec="util.CompoundDistribution">
        <distribution id="prior" spec="util.CompoundDistribution">
            <distribution id="YuleModel.t:test_output_0" spec="beast.evolution.speciation.YuleModel" birthDiffRate="@birthRate.t:test_output_0" tree="@Tree.t:test_output_0"/>
            <prior id="YuleBirthRatePrior.t:test_output_0" name="distribution" x="@birthRate.t:test_output_0">
                <Uniform id="Uniform.100" name="distr" upper="Infinity"/>
            </prior>
        </distribution>
        <distribution id="likelihood" spec="util.CompoundDistribution" useThreads="true">
            <distribution id="treeLikelihood.test_output_0" spec="ThreadedTreeLikelihood" data="@test_output_0" tree="@Tree.t:test_output_0">
                <siteModel id="SiteModel.s:test_output_0" spec="SiteModel">
                    <parameter id="mutationRate.s:test_output_0" estimate="false" name="mutationRate">1.0</parameter>
                    <parameter id="gammaShape.s:test_output_0" estimate="false" name="shape">1.0</parameter>
                    <parameter id="proportionInvariant.s:test_output_0" estimate="false" lower="0.0" name="proportionInvariant" upper="1.0">0.0</parameter>
                    <substModel id="JC69.s:test_output_0" spec="JukesCantor"/>
                </siteModel>
                <branchRateModel id="StrictClock.c:test_output_0" spec="beast.evolution.branchratemodel.StrictClockModel">
                    <parameter id="clockRate.c:test_output_0" estimate="false" name="clock.rate">1.0</parameter>
                </branchRateModel>
            </distribution>
        </distribution>
    </distribution>

    <operator id="YuleBirthRateScaler.t:test_output_0" spec="ScaleOperator" parameter="@birthRate.t:test_output_0" scaleFactor="0.75" weight="3.0"/>

    <operator id="YuleModelTreeScaler.t:test_output_0" spec="ScaleOperator" scaleFactor="0.5" tree="@Tree.t:test_output_0" weight="3.0"/>

    <operator id="YuleModelTreeRootScaler.t:test_output_0" spec="ScaleOperator" rootOnly="true" scaleFactor="0.5" tree="@Tree.t:test_output_0" weight="3.0"/>

    <operator id="YuleModelUniformOperator.t:test_output_0" spec="Uniform" tree="@Tree.t:test_output_0" weight="30.0"/>

    <operator id="YuleModelSubtreeSlide.t:test_output_0" spec="SubtreeSlide" tree="@Tree.t:test_output_0" weight="15.0"/>

    <operator id="YuleModelNarrow.t:test_output_0" spec="Exchange" tree="@Tree.t:test_output_0" weight="15.0"/>

    <operator id="YuleModelWide.t:test_output_0" spec="Exchange" isNarrow="false" tree="@Tree.t:test_output_0" weight="3.0"/>

    <operator id="YuleModelWilsonBalding.t:test_output_0" spec="WilsonBalding" tree="@Tree.t:test_output_0" weight="3.0"/>

    <logger id="tracelog" fileName="test_output_0.log" logEvery="1000" model="@posterior" sanitiseHeaders="true" sort="smart">
        <log idref="posterior"/>
        <log idref="likelihood"/>
        <log idref="prior"/>
        <log idref="treeLikelihood.test_output_0"/>
        <log id="TreeHeight.t:test_output_0" spec="beast.evolution.tree.TreeHeightLogger" tree="@Tree.t:test_output_0"/>
        <log idref="YuleModel.t:test_output_0"/>
        <log idref="birthRate.t:test_output_0"/>
    </logger>

    <logger id="screenlog" logEvery="1000">
        <log idref="posterior"/>
        <log id="ESS.0" spec="util.ESS" arg="@posterior"/>
        <log idref="likelihood"/>
        <log idref="prior"/>
    </logger>

    <logger id="treelog.t:test_output_0" fileName="$(tree).trees" logEvery="1000" mode="tree">
        <log id="TreeWithMetaDataLogger.t:test_output_0" spec="beast.evolution.tree.TreeWithMetaDataLogger" tree="@Tree.t:test_output_0"/>
    </logger>

</run>

</beast>
richelbilderbeek commented 5 years ago

This works:

richel@sonic:~$ ./beast -validate ~/Downloads/for_richel.xml 

                        BEAST v2.6.0, 2002-2019
             Bayesian Evolutionary Analysis Sampling Trees
                       Designed and developed by
 Remco Bouckaert, Alexei J. Drummond, Andrew Rambaut & Marc A. Suchard

                   Centre for Computational Evolution
                         University of Auckland
                       r.bouckaert@auckland.ac.nz
                        alexei@cs.auckland.ac.nz

                   Institute of Evolutionary Biology
                        University of Edinburgh
                           a.rambaut@ed.ac.uk

                    David Geffen School of Medicine
                 University of California, Los Angeles
                           msuchard@ucla.edu

                      Downloads, Help & Resources:
                           http://beast2.org/

  Source code distributed under the GNU Lesser General Public License:
                   http://github.com/CompEvol/beast2

                           BEAST developers:
   Alex Alekseyenko, Trevor Bedford, Erik Bloomquist, Joseph Heled, 
 Sebastian Hoehna, Denise Kuehnert, Philippe Lemey, Wai Lok Sibon Li, 
Gerton Lunter, Sidney Markowitz, Vladimir Minin, Michael Defoin Platel, 
          Oliver Pybus, Tim Vaughan, Chieh-Hsi Wu, Walter Xie

                               Thanks to:
          Roald Forsberg, Beth Shapiro and Korbinian Strimmer

Random number seed: 1566912621931

File: for_richel.xml seed: 1566912621931 threads: 1
Loading package BEASTLabs v1.9.0
Loading package NS v1.1.0
Loading package MODEL_SELECTION v1.5.0
Loading package BEAST v2.6.0
Loading package BEAST v2.6.0
t1: 20 4
t2: 20 4
t3: 20 4
t4: 20 4
t5: 20 4
Alignment(test_output_0)
  5 taxa
  20 sites
  16 patterns

Failed to load BEAGLE library: no hmsbeagle-jni in java.library.path: [/usr/local/lib, /usr/java/packages/lib, /usr/lib/x86_64-linux-gnu/jni, /lib/x86_64-linux-gnu, /usr/lib/x86_64-linux-gnu, /usr/lib/jni, /lib, /usr/lib]
TreeLikelihood(treeLikelihood.test_output_00) uses BeerLikelihoodCore4
  Alignment(test_output_0): [taxa, patterns, sites] = [5, 16, 20]
===============================================================================
Citations for this model:

Bouckaert, Remco, Timothy G. Vaughan, Joëlle Barido-Sottani, Sebastián Duchêne, 
  Mathieu Fourment, Alexandra Gavryushkina, Joseph Heled et al. 
  BEAST 2.5: An advanced software platform for Bayesian evolutionary analysis. 
  PLoS computational biology 15, no. 4 (2019): e1006650.

===============================================================================
Done!
richelbilderbeek commented 5 years ago

Top! Hmmm, de XML doet het gewoon bij mij.

Volgende stappen:

1) Wat zegt:

./beast -version

(waar beast verwijst naar de BEAST2 binary (niet de jar)).

Als dit lager is dan v2.6.0, verwijder dan BEAST2 en doe dan:

beastier::install_beast2()

om de nieuwste te krijgen.

Doet 'ie het dan?

2) wat zegt:

./beast -validate for_richel.xml

(waar beast verwijst naar de BEAST2 binary (niet de jar))

richelbilderbeek commented 5 years ago

P.S. er zat een bug in mcbette. Updaten naar mcbette v1.6 en misschien dat 'ie het dan doet?

richelbilderbeek commented 5 years ago

Error is replicated in this beastier macos log.

richelbilderbeek commented 5 years ago

Error is replicated in this AppVeyor (Windows) build log

richelbilderbeek commented 5 years ago

Warning is replicated in this Travis Linux build log

richelbilderbeek commented 5 years ago

I think the warnings/errors are caused by this: I usually test with the binary BEAST2, where the warnings pop up with the .jar file. The way the BEAST2 command is created to validate a file is different:

binary:

  cmds <- c(
    beast2_bin_path,
    "-validate",
    input_filename
  )

jar:

  cmds <- c(
    get_default_java_path(),
    "-jar",
    paste0("\"", beast2_jar_path, "\""),
    "-validate",
    paste0("\"", input_filename, "\"")
  )

I am unsure which one is the superior option on Windows and Mac, because I cannot easily test on those platforms.

richelbilderbeek commented 5 years ago

Note that when I run the command on my local computer, everything works.

I did modify /extdata to inst/extdata, would that be the cause of the warning?

richel@sonic:~$ '/usr/bin/java' -jar "/home/richel/.local/share/beast/lib/launcher.jar" -validate "/home/richel/GitHubs/mauricer/inst/extdata/nested_sampling.xml" 2>&1

                        BEAST v2.6.0, 2002-2019
             Bayesian Evolutionary Analysis Sampling Trees
                       Designed and developed by
 Remco Bouckaert, Alexei J. Drummond, Andrew Rambaut & Marc A. Suchard

                   Centre for Computational Evolution
                         University of Auckland
                       r.bouckaert@auckland.ac.nz
                        alexei@cs.auckland.ac.nz

                   Institute of Evolutionary Biology
                        University of Edinburgh
                           a.rambaut@ed.ac.uk

                    David Geffen School of Medicine
                 University of California, Los Angeles
                           msuchard@ucla.edu

                      Downloads, Help & Resources:
                           http://beast2.org/

  Source code distributed under the GNU Lesser General Public License:
                   http://github.com/CompEvol/beast2

                           BEAST developers:
   Alex Alekseyenko, Trevor Bedford, Erik Bloomquist, Joseph Heled, 
 Sebastian Hoehna, Denise Kuehnert, Philippe Lemey, Wai Lok Sibon Li, 
Gerton Lunter, Sidney Markowitz, Vladimir Minin, Michael Defoin Platel, 
          Oliver Pybus, Tim Vaughan, Chieh-Hsi Wu, Walter Xie

                               Thanks to:
          Roald Forsberg, Beth Shapiro and Korbinian Strimmer

Random number seed: 1566979876338

File: nested_sampling.xml seed: 1566979876338 threads: 1
Loading package BEASTLabs v1.9.0
Loading package NS v1.1.0
Loading package MODEL_SELECTION v1.5.0
Loading package BEAST v2.6.0
Loading package BEAST v2.6.0
61430_aco: 78 4
626029_aco: 78 4
630116_aco: 78 4
630210_aco: 78 4
B25702_aco: 78 4
Alignment(anthus_aco_sub)
  5 taxa
  78 sites
  9 patterns

Failed to load BEAGLE library: no hmsbeagle-jni in java.library.path: [/usr/java/packages/lib, /usr/lib/x86_64-linux-gnu/jni, /lib/x86_64-linux-gnu, /usr/lib/x86_64-linux-gnu, /usr/lib/jni, /lib, /usr/lib]
TreeLikelihood(treeLikelihood.anthus_aco_sub0) uses BeerLikelihoodCore4
  Alignment(anthus_aco_sub): [taxa, patterns, sites] = [5, 9, 78]
===============================================================================
Citations for this model:

Patricio Maturana, Brendon J. Brewer, Steffen Klaere, Remco Bouckaert. Model selection and parameter inference in phylogenetics using Nested Sampling. Systematic Biology, syy050, 2018

===============================================================================
Counting 19 parameters
Done!
richelbilderbeek commented 5 years ago

Nope, also calling from the installed R libraries, for both R version 3.4 and 3.6, everything works:

R v3.6

richel@sonic:~$ '/usr/bin/java' -jar "/home/richel/.local/share/beast/lib/launcher.jar" -validate "/home/richel/R/x86_64-pc-linux-gnu-library/3.6/mauricer/extdata//nested_sampling.xml" 2>&1

                        BEAST v2.6.0, 2002-2019
             Bayesian Evolutionary Analysis Sampling Trees
                       Designed and developed by
 Remco Bouckaert, Alexei J. Drummond, Andrew Rambaut & Marc A. Suchard

                   Centre for Computational Evolution
                         University of Auckland
                       r.bouckaert@auckland.ac.nz
                        alexei@cs.auckland.ac.nz

                   Institute of Evolutionary Biology
                        University of Edinburgh
                           a.rambaut@ed.ac.uk

                    David Geffen School of Medicine
                 University of California, Los Angeles
                           msuchard@ucla.edu

                      Downloads, Help & Resources:
                           http://beast2.org/

  Source code distributed under the GNU Lesser General Public License:
                   http://github.com/CompEvol/beast2

                           BEAST developers:
   Alex Alekseyenko, Trevor Bedford, Erik Bloomquist, Joseph Heled, 
 Sebastian Hoehna, Denise Kuehnert, Philippe Lemey, Wai Lok Sibon Li, 
Gerton Lunter, Sidney Markowitz, Vladimir Minin, Michael Defoin Platel, 
          Oliver Pybus, Tim Vaughan, Chieh-Hsi Wu, Walter Xie

                               Thanks to:
          Roald Forsberg, Beth Shapiro and Korbinian Strimmer

Random number seed: 1566980034812

File: nested_sampling.xml seed: 1566980034812 threads: 1
Loading package BEASTLabs v1.9.0
Loading package NS v1.1.0
Loading package MODEL_SELECTION v1.5.0
Loading package BEAST v2.6.0
Loading package BEAST v2.6.0
61430_aco: 78 4
626029_aco: 78 4
630116_aco: 78 4
630210_aco: 78 4
B25702_aco: 78 4
Alignment(anthus_aco_sub)
  5 taxa
  78 sites
  9 patterns

Failed to load BEAGLE library: no hmsbeagle-jni in java.library.path: [/usr/java/packages/lib, /usr/lib/x86_64-linux-gnu/jni, /lib/x86_64-linux-gnu, /usr/lib/x86_64-linux-gnu, /usr/lib/jni, /lib, /usr/lib]
TreeLikelihood(treeLikelihood.anthus_aco_sub0) uses BeerLikelihoodCore4
  Alignment(anthus_aco_sub): [taxa, patterns, sites] = [5, 9, 78]
===============================================================================
Citations for this model:

Patricio Maturana, Brendon J. Brewer, Steffen Klaere, Remco Bouckaert. Model selection and parameter inference in phylogenetics using Nested Sampling. Systematic Biology, syy050, 2018

===============================================================================
Counting 19 parameters
Done!

R v3.4

richel@sonic:~$ '/usr/bin/java' -jar "/home/richel/.local/share/beast/lib/launcher.jar" -validate "/home/richel/R/x86_64-pc-linux-gnu-library/3.4/mauricer/extdata//nested_sampling.xml" 2>&1

                        BEAST v2.6.0, 2002-2019
             Bayesian Evolutionary Analysis Sampling Trees
                       Designed and developed by
 Remco Bouckaert, Alexei J. Drummond, Andrew Rambaut & Marc A. Suchard

                   Centre for Computational Evolution
                         University of Auckland
                       r.bouckaert@auckland.ac.nz
                        alexei@cs.auckland.ac.nz

                   Institute of Evolutionary Biology
                        University of Edinburgh
                           a.rambaut@ed.ac.uk

                    David Geffen School of Medicine
                 University of California, Los Angeles
                           msuchard@ucla.edu

                      Downloads, Help & Resources:
                           http://beast2.org/

  Source code distributed under the GNU Lesser General Public License:
                   http://github.com/CompEvol/beast2

                           BEAST developers:
   Alex Alekseyenko, Trevor Bedford, Erik Bloomquist, Joseph Heled, 
 Sebastian Hoehna, Denise Kuehnert, Philippe Lemey, Wai Lok Sibon Li, 
Gerton Lunter, Sidney Markowitz, Vladimir Minin, Michael Defoin Platel, 
          Oliver Pybus, Tim Vaughan, Chieh-Hsi Wu, Walter Xie

                               Thanks to:
          Roald Forsberg, Beth Shapiro and Korbinian Strimmer

Random number seed: 1566980054876

File: nested_sampling.xml seed: 1566980054876 threads: 1
Loading package BEASTLabs v1.9.0
Loading package NS v1.1.0
Loading package MODEL_SELECTION v1.5.0
Loading package BEAST v2.6.0
Loading package BEAST v2.6.0
61430_aco: 78 4
626029_aco: 78 4
630116_aco: 78 4
630210_aco: 78 4
B25702_aco: 78 4
Alignment(anthus_aco_sub)
  5 taxa
  78 sites
  9 patterns

Failed to load BEAGLE library: no hmsbeagle-jni in java.library.path: [/usr/java/packages/lib, /usr/lib/x86_64-linux-gnu/jni, /lib/x86_64-linux-gnu, /usr/lib/x86_64-linux-gnu, /usr/lib/jni, /lib, /usr/lib]
TreeLikelihood(treeLikelihood.anthus_aco_sub0) uses BeerLikelihoodCore4
  Alignment(anthus_aco_sub): [taxa, patterns, sites] = [5, 9, 78]
===============================================================================
Citations for this model:

Patricio Maturana, Brendon J. Brewer, Steffen Klaere, Remco Bouckaert. Model selection and parameter inference in phylogenetics using Nested Sampling. Systematic Biology, syy050, 2018

===============================================================================
Counting 19 parameters
Done!
richelbilderbeek commented 5 years ago

This is fixed.