bug in bold_identify_parents?

[VascoElbrecht]

Hello,

bold_identify_parents works fine for me for now, but one sequence does produce an error.

When running:

hittable <- bold_identify("AACGTTATATTTTATTTTTGGAGCATGATCAGGAATAGTAGGAACTTCTTTAAGAATTTTAATTCGAGCTGAATTAGGTCACCCTGGAACATTAATTGGAGATGACCAAATTTATAATGTTATTGTTACAGCACATGCTTTTGTTATAATTTTTTTTATAGTTATACCAATTTTAATT", db="COX1")`
hittable <- bold_identify_parents(hittable, wide=T)

I get the following error:

Error in apply(h, 1, function(x) { : dim(X) must have a positive length

in the bold_identify_parents command. This happens every time I try to run it with this sequence. Could you please look into this? Thanks = )

here also my R session info:

sessionInfo()
R version 3.3.2 (2016-10-31)
Platform: x86_64-apple-darwin13.4.0 (64-bit)
Running under: OS X El Capitan 10.11.6

locale:
[1] en_US.UTF-8/en_US.UTF-8/en_US.UTF-8/C/en_US.UTF-8/en_US.UTF-8

attached base packages:
[1] stats     graphics  grDevices utils     datasets  methods   base     

other attached packages:
[1] JAMP_0.1     bold_0.4.0   seqinr_3.3-3

loaded via a namespace (and not attached):
 [1] Rcpp_0.12.8       reshape_0.8.6     assertthat_0.1    R6_2.2.0         
 [5] plyr_1.8.4        jsonlite_1.2      magrittr_1.5      httr_1.2.1       
 [9] stringi_1.1.2     curl_2.3          data.table_1.10.0 xml2_1.1.0       
[13] tools_3.3.2       stringr_1.1.0     ade4_1.7-5

[sckott]

thanks @VascoElbrecht - can reproduce that, will get a fix soon

[VascoElbrecht]

great = ) thank you!

[sckott]

@VascoElbrecht reinstall and try again, should work now

[dougwyu]

aha, there's a tribe column in this set of hits!

[VascoElbrecht]

Yes! It works now, thank you = )