search

ropensci / taxa

taxonomic classes for R
https://docs.ropensci.org/taxa
Other
48 stars 12 forks source link

Taxmap print method: edgelist takes long time to print when taxonomy is large #176

Closed zachary-foster closed 5 years ago

zachary-foster commented 6 years ago 
> print(silva)
<Taxmap>
  147708 taxa: aaab. Eukaryota ... iknc. Albula vulpes (bonefish)
  147708 edges: NA->aaab, NA->aaac ... ijph->iknb, ijpn->iknc
  1 data sets:
    tax_data:
      # A tibble: 598,470 x 5
        taxon_id id              class   input  sequence             
        <chr>    <chr>           <chr>   <chr>  <chr>                
      1 ghyh     AB001438.1.1662 Eukary… AB001… GAAACUGCGAAUGGCUCAUU…
      2 ghyi     AB006051.1.1796 Eukary… AB006… UACCUGGUUGAUCCUGCCAG…
      3 hcfq     FJ911802.1.1606 Eukary… FJ911… GGGAUGUGAUUUGUUAAUUG…
      # ... with 5.985e+05 more rows
  0 functions:

This took about 20 seconds to print, mostly seemed to be when printing the edge list. Could be caused by taxon id verification. Might want to urn that off for large objects.

zachary-foster commented 5 years ago

Fixed in eval branch