search

rraadd88 / beditor

A Computational Workflow for Designing Libraries of sgRNAs for CRISPR-Mediated Base Editing, and much more
GNU General Public License v3.0
17 stars 4 forks source link

gRNA not identfied #6

Closed herrroaa closed 5 years ago

herrroaa commented 5 years ago

Hi,

I am trying to design a gRNA for base editor SA(KKH)-BE3 (pam:NNNRRT). The sequence flanking my SNP ( bold C) from file 01_sequences/dbedntmuts.fa is GAAATGTTTGAGGATGACTCCTCGCAGCCTGGTCCCCACCCCAAT

There is a good pam sequence CCCAAT, however no gRNA was designed There is also an error message

ERROR from pipeline.py in make_outputs(..):215: output of step 2 or 3 are missing.

Thanks T

rraadd88 commented 5 years ago

Hi @herrroaa , I wonder why that happened. Could you send me the yaml (.yml) configuration file to have a look? Thank you for posting this issue.

Rohan

herrroaa commented 5 years ago

Hi @rraadd88 , Please find attached the .yml file, I just changed the extension to txt be compatible rs2229774.txt

Thanks for replying to the issue, Tarek

herrroaa commented 5 years ago

Hi @rraadd88 Did you have time to look into the yml file? Thanks, Tarek

rraadd88 commented 5 years ago

Hi @herrroaa , I will have a look today or over the weekends. My guess is that the the gRNAs were filtered out in the process. I will see exactly at which step that happened. Thanks for the reminder.

rraadd88 commented 5 years ago

Hi @herrroaa , As I see the sequence at the genome coordinates of the SNP rs2229774, it seems that the SNP is on positive strand but the sequence that you mentioned in the first comment is from negative strand. image It seems to be the case of incorrect strand information in your SNP.tsv file. My guess is that SNP.tsv should look like this.

genome coordinate nucleotide mutation
12:53211761-53211761+ A
12:53211761-53211761+ T
12:53211761-53211761+ G
12:53211761-53211761+ C

In the nucleotide mutation column you may wanna mention only the mutation that you'd like to create.

herrroaa commented 5 years ago

Hi @rraadd88 , I want to convert C to T for SNP rs2229774 . The C allele is located at the reverse strand to chr12. https://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?do_not_redirect&rs=rs2229774

I tried using 12:53211761-53211761+ T and 12:53211761-53211761- T.

The sequence flanking my SNP from file 01_sequences/dbedntmuts.fa are

12:53211761-53211761+(+) ATTGGGGTGGGGACCAGGCTGC**G**AGGAGTCATCCTCAAACATTTC 12:53211761-53211761-(-) GAAATGTTTGAGGATGACTCCT**C**GCAGCCTGGTCCCCACCCCAAT

Both analysis gave me the same error beditor --cfg /Users/tarekmagdyshehatamohamed/Documents/BE/rs2229774.yml

Namespace(cfg='/Users/tarekmagdyshehatamohamed/Documents/BE/rs2229774.yml', force=False, step=None, test=False)
start. log file: .log_beditor_2019_05_29_13_55_04_278247__Users_tarekmagdyshehatamohamed_Documents_BE_rs2229774.yml_None_False_False.log
/Users/tarekmagdyshehatamohamed/miniconda3/envs/beditor/lib/python3.6/site-packages/beditor/pipeline.py:245: YAMLLoadWarning: calling yaml.load() without Loader=... is deprecated, as the default Loader is unsafe. Please read https://msg.pyyaml.org/load for full details.
  cfg=yaml.load(open(cfgp, 'r'))
2019_05_29_13_55_04_977905: processing: rs2229774
2019_05_29_13_55_05_641331: processing: 1 chunks.
/Users/tarekmagdyshehatamohamed/miniconda3/envs/beditor/lib/python3.6/site-packages/beditor/pipeline.py:34: YAMLLoadWarning: calling yaml.load() without Loader=... is deprecated, as the default Loader is unsafe. Please read https://msg.pyyaml.org/load for full details.
  cfg=yaml.load(open(cfgp, 'r'))
2019_05_29_13_55_05_664798: processing: chunk00000001
2019_05_29_13_55_07_099245: collecting chunks
2019_05_29_13_55_07_127665: generating outputs
[2019-05-29 13:55:07,142] ERROR from pipeline.py in make_outputs(..):215: output of step 2 or 3 are missing.

Thanks for your cooperation

rraadd88 commented 5 years ago

Hi @herrroaa , Thanks for your patience, if you haven't figured out the issue by yourself already. The issue was activity window, using the default activity window does not work. I saved the guides without the filtering of based on activity window. test.txt

This is what you wanted I guess. Best wishes,

Rohan [Closing the issue now.]