Closed nextgenusfs closed 6 years ago
Hmmm, this one is mysterious to me. I made +
the default quality score (Phred of 10, i.e. 90% accurate). But it should only appear if your input is FASTA and your output is FASTQ, which is an odd scenario. If both your input and output are FASTQ (much more typical), then that shouldn't happen, so I suspect you've found a bug.
I can't reproduce the problem myself. If I make a broken FASTQ with empty quality lines, then I get the ++++++++
, but not otherwise. Even your example read works. If I use --adapter_threshold 75
(to ensure this one read is sufficient for finding the NB01 adapter) then I get this:
@channel_37_d6b322e5-b47b-4400-b152-ab15b84b12ce_template /Library/MinKNOW/data/reads/fail/0/cfmrs_mac_pro_fpl_fs_fed_us_20170307_FNFAF13190_MN18073_mux_scan_SWJ_Anid_54932_ch37_read188_strand.fast5
GTCTCTCCGACCAGGTCTTTAATGTGGTGTTCATTAATTCTCCGATCGTCTTGGTCCATGGTGCATGCATCGCGTGCTGGGATCTTTGCCCTTCTCGCAAACGCAAATCCGCACTGATCTCGACAAGCATCATCAACAGCCAGCGGACTATAAGCCACAGCGGCATGCAGCGCAGTCTCCCATCTCCGTTGGCCGTAATGTTGAAACAACTCGGCTGACCCTCGGATGATTCGCTAACCAGCGGTCCCCTTCATGCCAAGATGCACGGCTATCCTCTTCTCGTCCTGGGGTCAGCATCTGCCTCCTTCGTCGCCGCTACCGGCGGACATCTGCATCCGTTCTCTGCGGTTGCGAGGACCGCGGGTGCGCGTTGGTGGCTCGCGAAGGGCGCGCTGATCATCCTGGCCGCGGTGGGCCATGCGGGATGGAGATCTGCGCGCGCACGCGCGTACGCGCTA
+
$&,.,(/.*'%'$%'&#*+).02/1.)(&)(%&$)$$'),,,1/112-*)%$%*()+&$#)*&&$''*)*3-,0/,./01,&$'&*,*,2+*,--0('/1..#$$$()+-*,(+,1/2+(-&+2++)+**))(.(,1%+0((&.&)+**)+,'(.2)/*'+'),+1-*))*$(&%(*(*3)-',*2/)*.%''((&%$+*.2.,+-))&$&(#$##%&25++-+1/,*(-1*))*+0,/(*+,*)..-)'+*.)$*)(&*()%+))*,,(%(00--0/,,/.)+%$%/1-,-.'0+*)#%./*0./31/4,(+./11)..,),(.*)(*(&&&$*31/-+,-.*-/*/1/0(&#'(&%&&&'&&*++,(('&)))&&'&'&%($&'**1+,)%%+)(*))))-0.1.((*&((+'')#$%)',)'+(.'**++'+&')((&$#%$&%%###&$$#%"#
Perhaps Porechop is making a mistake when parsing your FASTQ? Does the file contain strange line ending characters or something? If there are no data privacy issues with doing so, could you share the reads with me? Or perhaps a subset of the reads which has the same problem?
Thanks, Ryan
This is an old issue, so I'm going to close it now. But please let me know if you're still experiencing unresolved issues!
Ryan
When working with FASTQ, seems like the quality scores are not being retained, i.e. Here is original read:
And here is "trimmed" output read.