rrwick / Porechop

adapter trimmer for Oxford Nanopore reads
GNU General Public License v3.0
322 stars 123 forks source link

Add barcode 12a (RB12A) #63

Open devindrown opened 6 years ago

devindrown commented 6 years ago

https://github.com/rrwick/Porechop/blob/289d5dca4a5fc327f97b3f8cecb68ecaf1014861/porechop/adapters.py#L53

Rapid PCR Barcoding Kit (code SQK-RPB004) is being distributed with a modified barcode 12 (now 12a). See community documentation link . Any chance to add this barcode?

RB12A: GTTGAGTTACAAAGCACCGATCAG