search

rrwick / Porechop

adapter trimmer for Oxford Nanopore reads
GNU General Public License v3.0
340 stars 128 forks source link

I would like to add custom barcodes, but retain native (Ligation kit) adapters #87

Open l-yampolsky opened 4 years ago

l-yampolsky commented 4 years ago

Don't think anyone is answering issues here, but let's try. I understand that I can add custom barcodes. To do so I would edit adapters.py by removing any barcodes present there and including my custom adapters, names starting with 'Barcode' and with sequence that consists of the OTN adapter sequence followed by my barcode. To do this I need to identify the right adapters (Ligation kit) in adapters.py and add my barcodes to their sequences. The file adapters.py does not mention "Ligation" or "SQK-LSK109" anywere, nor does it include anything close to the sequence that most commonly occurs in the beginning of my reads (which is TCAGTACTTCGTTCAGTTACGTATTGCT or similar).

Any ideas?

amv33576 commented 4 years ago

Where you able to solve this problem? I am trying the accomplish something similar.

Manesskuggen commented 3 years ago

Hello,

Same issue here ...