When hts_Primers is run with a fasta file containing more than one entry, the following error is reported (although the values change depending on the fasta file record IDs):
ERROR: Unhandled Exception: basic_string::substr: __pos (which is 9) > this->size() (which is 8)
When hts_Primers is run with a fasta file containing more than one entry, the following error is reported (although the values change depending on the fasta file record IDs):
ERROR: Unhandled Exception: basic_string::substr: __pos (which is 9) > this->size() (which is 8)
hts version: $ hts_Primers --version v1.3.2-9-g438994d
To reproduce, download and unpack: test_data.zip
Running with a file containing two primers should cause the Uhandled Exception
hts_Primers -d 0 -l 0 -e 0 -r 2 -x -P ACATTACAGTGGTATCAACGCAGAGTACA \ -Q two_primers.fasta -1 Read1.fastq.gz -2 Read2.fastq.gz -L htslog.json
Running with a file containing one primer should produce normal output:
hts_Primers -d 0 -l 0 -e 0 -r 2 -x -P ACATTACAGTGGTATCAACGCAGAGTACA \ -Q one_primer.fasta -1 Read1.fastq.gz -2 Read2.fastq.gz -L htslog.json