search

sanger-pathogens / assembly_improvement

Improve the quality of a denovo assembly by scaffolding and gap filling
Other
56 stars 21 forks source link

Trying to use SSpace-Long Read #70

Open subnandakumar opened 7 years ago

subnandakumar commented 7 years ago

I have pre-assembled contigs from Canu.

When I run the script: It gives me an error: Please insert a file with contig sequences. You've inserted '/SSPACE/SSPACE-LongRead_v1-1/runs/data/contigs.fasta' which either does not exist or is not filled in

However this is a file that consists all the. contigs.

Eg of header:

tig00000001 len=1248915 reads=5062 covStat=1331.73 gappedBases=no class=contig suggestRepeat=no suggestCircular=no TACTAAGCTCCTTACTAGAGGCATCATAATATTATCCCTTTACCTATTAGCATAAGTCTTATTCTTCATTCTTCTACAAAAACCTAAACCATCCAAAAAT

jacquikeane commented 7 years ago

Could you provide us with the exact command that you ran?