Errors on zUMIs.sh: command substitution: line 235: `cut -d' ' -f1 <(echo ${fqfiles}))'

[loverlyday]

hi, i get a error like this: You provided these parameters: YAML file: run2.yaml zUMIs directory: /home/xxx/biosoft/zUMIs-main STAR executable STAR samtools executable samtools pigz executable pigz Rscript executable Rscript RAM limit: 100 zUMIs version 2.9.4f

Thu Jan 28 10:16:40 CST 2021 WARNING: The STAR version used for mapping is 2.7.3a and the STAR index was created using the version 2.7.1a. This may lead to an error while mapping. If you encounter any errors at the mapping stage, please make sure to create the STAR index using STAR 2.7.3a. Filtering... /home/xxx/biosoft/zUMIs-main/zUMIs.sh: command substitution: line 235: syntax error near unexpected token (' /home/xxx/biosoft/zUMIs-main/zUMIs.sh: command substitution: line 235:cut -d' ' -f1 <(echo ${fqfiles}))'

the yaml file like this: project: no10A sequence_files: file1: name: /home/xxx/smartseq3/test/L3_R1.fastq.gz base_definition:

• cDNA(1-150) file2: name: /home/xxxx/smartseq3/test/L3_R2.fastq.gz base_definition:
• BC(23-38)
• UMI(39-48) find_pattern: CTACACGACGCTCTTCCGATCT reference: STAR_index: /home/xxx/ref/Macaca_fascicularis_5.0_STAR2.7.3a_index GTF_file: /home/xxx/index/Macaca_fascicularis_5.0/Macaca_fascicularis.Macaca_fascicularis_5.0.98.gtf additional_STAR_params: '--limitSjdbInsertNsj 2000000' additional_files: out_dir: /home/xxx/smartseq3/test num_threads: 40 mem_limit: 100 filter_cutoffs: BC_filter: num_bases: 3 phred: 20 UMI_filter: num_bases: 3 phred: 20 barcodes: barcode_num: ~ barcode_file: /home/xxxx/smartseq3/test/barcode.txt automatic: no BarcodeBinning: 1 nReadsperCell: 100 demultiplex: yes counting_opts: introns: yes downsampling: '0' strand: 0 Ham_Dist: 1 write_ham: yes velocyto: no primaryHit: yes twoPass: no make_stats: yes which_Stage: Filtering read_layout: SE

it is so strange that i can't find why.The zUMIs works fine yesterday,but get the error now.I can't figure out what happened. Can you suggest a solution? Thanks

[sdparekh]

Can you show a couple of reads from your fastq file

[cziegenhain]

i agree with @sdparekh that a look into the fastq file would be helpful. Otherwise could it also be a formatting/indentation issue in the YAML config file? Happy to check that if you attach it as a file instead of copying the text (which loses the indentation in GitHub).

[loverlyday]

thank a lot .I have solved it.use the command: bash zUMIs.sh -y xxx.yaml rather than sh zUMIs.sh -y xxx.yaml