search

sdparekh / zUMIs

zUMIs: A fast and flexible pipeline to process RNA sequencing data with UMIs
GNU General Public License v3.0
271 stars 67 forks source link

zUMIs alignment error #294

Closed brain-discourse closed 2 years ago

brain-discourse commented 2 years ago

Hello all,

I am working on the analysis of a single cell forebrain organoid dataset utilizing smartseq2 obtained from sra. this is a single end sequencing file with 125bp reads. I used the Rscript for adding barcodes for demultiplexed samples and proceeded with the zUMI pipeline. I am having issues with the alignment step of the pipeline. I initially thought that the fastq file I created was wrong so I ran STAR normally on my the merged fastq file and it seemed to work okay. I was hoping you could help me troubleshoot this issue. Would appreciate any input. My zUMI star log.final.output files look like this: `Started job on | Nov 28 10:40:03 Started mapping on | Nov 28 11:28:20 Finished on | Nov 28 11:31:24 Mapping speed, Million of reads per hour | 128.19

                      Number of input reads |   6552096
                  Average input read length |   1
                                UNIQUE READS:
               Uniquely mapped reads number |   0
                    Uniquely mapped reads % |   0.00%
                      Average mapped length |   0.00
                   Number of splices: Total |   0
        Number of splices: Annotated (sjdb) |   0
                   Number of splices: GT/AG |   0
                   Number of splices: GC/AG |   0
                   Number of splices: AT/AC |   0
           Number of splices: Non-canonical |   0
                  Mismatch rate per base, % |   -nan%
                     Deletion rate per base |   0.00%
                    Deletion average length |   0.00
                    Insertion rate per base |   0.00%
                   Insertion average length |   0.00
                         MULTI-MAPPING READS:
    Number of reads mapped to multiple loci |   0
         % of reads mapped to multiple loci |   0.00%
    Number of reads mapped to too many loci |   0
         % of reads mapped to too many loci |   0.00%
                              UNMAPPED READS:

Number of reads unmapped: too many mismatches | 0 % of reads unmapped: too many mismatches | 0.00% Number of reads unmapped: too short | 0 % of reads unmapped: too short | 0.00% Number of reads unmapped: other | 6552096 % of reads unmapped: other | 100.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% Started job on | Nov 28 10:40:03 Started mapping on | Nov 28 11:28:26 Finished on | Nov 28 11:31:26 Mapping speed, Million of reads per hour | 131.04

                      Number of input reads |   6552096
                  Average input read length |   1
                                UNIQUE READS:
               Uniquely mapped reads number |   0
                    Uniquely mapped reads % |   0.00%
                      Average mapped length |   0.00
                   Number of splices: Total |   0
        Number of splices: Annotated (sjdb) |   0
                   Number of splices: GT/AG |   0
                   Number of splices: GC/AG |   0
                   Number of splices: AT/AC |   0
           Number of splices: Non-canonical |   0
                  Mismatch rate per base, % |   -nan%
                     Deletion rate per base |   0.00%
                    Deletion average length |   0.00
                    Insertion rate per base |   0.00%
                   Insertion average length |   0.00
                         MULTI-MAPPING READS:
    Number of reads mapped to multiple loci |   0
         % of reads mapped to multiple loci |   0.00%
    Number of reads mapped to too many loci |   0
         % of reads mapped to too many loci |   0.00%
                              UNMAPPED READS:

Number of reads unmapped: too many mismatches | 0 % of reads unmapped: too many mismatches | 0.00% Number of reads unmapped: too short | 0 % of reads unmapped: too short | 0.00% Number of reads unmapped: other | 6552096 % of reads unmapped: other | 100.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% Started job on | Nov 28 10:40:03 Started mapping on | Nov 28 11:25:55 Finished on | Nov 28 11:27:39 Mapping speed, Million of reads per hour | 217.74

                      Number of input reads |   6290175
                  Average input read length |   1
                                UNIQUE READS:
               Uniquely mapped reads number |   0
                    Uniquely mapped reads % |   0.00%
                      Average mapped length |   0.00
                   Number of splices: Total |   0
        Number of splices: Annotated (sjdb) |   0
                   Number of splices: GT/AG |   0
                   Number of splices: GC/AG |   0
                   Number of splices: AT/AC |   0
           Number of splices: Non-canonical |   0
                  Mismatch rate per base, % |   -nan%
                     Deletion rate per base |   0.00%
                    Deletion average length |   0.00
                    Insertion rate per base |   0.00%
                   Insertion average length |   0.00
                         MULTI-MAPPING READS:
    Number of reads mapped to multiple loci |   0
         % of reads mapped to multiple loci |   0.00%
    Number of reads mapped to too many loci |   0
         % of reads mapped to too many loci |   0.00%
                              UNMAPPED READS:

Number of reads unmapped: too many mismatches | 0 % of reads unmapped: too many mismatches | 0.00% Number of reads unmapped: too short | 0 % of reads unmapped: too short | 0.00% Number of reads unmapped: other | 6290175 % of reads unmapped: other | 100.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00%`

Standalone STAR run output: `Started job on | Nov 28 09:25:30 Started mapping on | Nov 28 09:25:31 Finished on | Nov 28 09:43:02 Mapping speed, Million of reads per hour | 66.43

                      Number of input reads |   19394367
                  Average input read length |   126
                                UNIQUE READS:
               Uniquely mapped reads number |   15751117
                    Uniquely mapped reads % |   81.21%
                      Average mapped length |   123.90
                   Number of splices: Total |   5130852
        Number of splices: Annotated (sjdb) |   0
                   Number of splices: GT/AG |   5061233
                   Number of splices: GC/AG |   32010
                   Number of splices: AT/AC |   3515
           Number of splices: Non-canonical |   34094
                  Mismatch rate per base, % |   0.34%
                     Deletion rate per base |   0.01%
                    Deletion average length |   1.65
                    Insertion rate per base |   0.01%
                   Insertion average length |   1.34
                         MULTI-MAPPING READS:
    Number of reads mapped to multiple loci |   2108154
         % of reads mapped to multiple loci |   10.87%
    Number of reads mapped to too many loci |   8755
         % of reads mapped to too many loci |   0.05%
                              UNMAPPED READS:

Number of reads unmapped: too many mismatches | 0 % of reads unmapped: too many mismatches | 0.00% Number of reads unmapped: too short | 1520777 % of reads unmapped: too short | 7.84% Number of reads unmapped: other | 5564 % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00%`

yaml file: Smartseq2_organoid.txt

My zUMI log file `Using miniconda environment for zUMIs! note: internal executables will be used instead of those specified in the YAML file!

You provided these parameters: YAML file: /forebrain_organoids/fastq/zUMI_auto_ss2.yaml zUMIs directory: /forebrain_organoids/fastq/zUMIs STAR executable STAR samtools executable samtools pigz executable pigz Rscript executable Rscript RAM limit: 100 zUMIs version 2.9.7

Sun Nov 28 10:13:38 EST 2021 WARNING: The STAR version used for mapping is 2.7.3a and the STAR index was created using the version 2.7.1a. This may lead to an error while mapping. If you encounter any errors at the mapping stage, please make sure to create the STAR index using STAR 2.7.3a. Filtering... Sun Nov 28 10:39:56 EST 2021 Registered S3 methods overwritten by 'ggplot2': method from [.quosures rlang c.quosures rlang print.quosures rlang [1] " reads were assigned to barcodes that do not correspond to intact cells." Mapping... [1] "2021-11-28 10:39:57 EST" Nov 28 10:40:03 ..... started STAR run Nov 28 10:40:08 ..... loading genome Nov 28 10:40:03 ..... started STAR run Nov 28 10:40:08 ..... loading genome Nov 28 10:40:03 ..... started STAR run Nov 28 10:40:08 ..... loading genome Nov 28 10:41:18 ..... processing annotations GTF Nov 28 10:41:48 ..... inserting junctions into the genome indices Nov 28 10:47:29 ..... processing annotations GTF Nov 28 10:47:58 ..... processing annotations GTF Nov 28 10:51:52 ..... inserting junctions into the genome indices Nov 28 10:51:55 ..... inserting junctions into the genome indices Nov 28 11:25:55 ..... started mapping Nov 28 11:27:37 ..... finished mapping Nov 28 11:27:39 ..... finished successfully Nov 28 11:28:20 ..... started mapping Nov 28 11:28:26 ..... started mapping Nov 28 11:31:16 ..... finished mapping Nov 28 11:31:20 ..... finished mapping Nov 28 11:31:24 ..... finished successfully Nov 28 11:31:26 ..... finished successfully Sun Nov 28 11:31:30 EST 2021 Counting... Registered S3 methods overwritten by 'ggplot2': method from [.quosures rlang c.quosures rlang print.quosures rlang [1] "2021-11-28 11:31:41 EST" [1] "4.5e+08 Reads per chunk" [1] "Loading reference annotation from:" [1] "/forebrain_organoids/fastq/Smartseq2_organoid.final_annot.gtf" [1] "Annotation loaded!" Warning message: as_quosure() requires an explicit environment as of rlang 0.3.0. Please supply env. This warning is displayed once per session. Warning message: In parallel::mclapply(gtf_info, function(x) { : scheduled cores 1, 2, 3, 4, 10, 19 did not deliver results, all values of the jobs will be affected [1] "Assigning reads to features (ex)"

    ==========     _____ _    _ ____  _____  ______          _____  
    =====         / ____| |  | |  _ \|  __ \|  ____|   /\   |  __ \ 
      =====      | (___ | |  | | |_) | |__) | |__     /  \  | |  | |
        ====      \___ \| |  | |  _ <|  _  /|  __|   / /\ \ | |  | |
          ====    ____) | |__| | |_) | | \ \| |____ / ____ \| |__| |
    ==========   |_____/ \____/|____/|_|  \_\______/_/    \_\_____/
   Rsubread 1.32.4
//========================== featureCounts setting ===========================\ Input files : 1 BAM file S Smartseq2_organoid.filtered.tagged.Aligned ...
Annotation : R data.frame
Assignment details : .featureCounts.bam
(Note that files are saved to the output directory)
Dir for temp files : .
Threads : 50
Level : meta-feature level
Paired-end : yes
Multimapping reads : counted
Multiple alignments : primary alignment only
Multi-overlapping reads : not counted
Min overlapping bases : 1
Chimeric reads : not counted
Both ends mapped : not required

\===================== http://subread.sourceforge.net/ ======================//

//================================= Running ==================================\ Load annotation file .Rsubread_UserProvidedAnnotation_pid232435 ... Features : 349261 Meta-features : 60676 Chromosomes/contigs : 47
Process BAM file Smartseq2_organoid.filtered.tagged.Aligned.out.bam...
Single-end reads are included.
Assign alignments to features...
Total alignments : 19394367
Successfully assigned alignments : 0 (0.0%)
Running time : 0.32 minutes

\===================== http://subread.sourceforge.net/ ======================//

[1] "Assigning reads to features (in)"

    ==========     _____ _    _ ____  _____  ______          _____  
    =====         / ____| |  | |  _ \|  __ \|  ____|   /\   |  __ \ 
      =====      | (___ | |  | | |_) | |__) | |__     /  \  | |  | |
        ====      \___ \| |  | |  _ <|  _  /|  __|   / /\ \ | |  | |
          ====    ____) | |__| | |_) | | \ \| |____ / ____ \| |__| |
    ==========   |_____/ \____/|____/|_|  \_\______/_/    \_\_____/
   Rsubread 1.32.4
//========================== featureCounts setting ===========================\ Input files : 1 BAM file S Smartseq2_organoid.filtered.tagged.Aligned ...
Annotation : R data.frame
Assignment details : .featureCounts.bam
(Note that files are saved to the output directory)
Dir for temp files : .
Threads : 50
Level : meta-feature level
Paired-end : yes
Multimapping reads : counted
Multiple alignments : primary alignment only
Multi-overlapping reads : not counted
Min overlapping bases : 1
Chimeric reads : not counted
Both ends mapped : not required

\===================== http://subread.sourceforge.net/ ======================//

//================================= Running ==================================\ Load annotation file .Rsubread_UserProvidedAnnotation_pid232435 ... Features : 240693 Meta-features : 28409 Chromosomes/contigs : 34
Process BAM file Smartseq2_organoid.filtered.tagged.Aligned.out.bam.ex ...
Single-end reads are included.
Assign alignments to features...
Total alignments : 19394367
Successfully assigned alignments : 0 (0.0%)
Running time : 0.35 minutes

\===================== http://subread.sourceforge.net/ ======================//

[1] "2021-11-28 11:42:30 EST" [1] "Coordinate sorting final bam file..." [bam_sort_core] merging from 0 files and 50 in-memory blocks... [1] "2021-11-28 11:42:51 EST" [1] "Here are the detected subsampling options:" [1] "Automatic downsampling" [1] "Working on barcode chunk 1 out of 1" [1] "Processing 50 barcodes in this chunk..." Error in .checkTypos(e, names_x) : Object 'GEin' not found amongst ftype Calls: reads2genes_new ... tryCatchList -> tryCatchOne -> -> .checkTypos Execution halted Sun Nov 28 11:43:02 EST 2021 Loading required package: yaml Loading required package: Matrix [1] "loomR found" Warning! HDF5 library version mismatched error The HDF5 header files used to compile this application do not match the version used by the HDF5 library to which this application is linked. Data corruption or segmentation faults may occur if the application continues. This can happen when an application was compiled by one version of HDF5 but linked with a different version of static or shared HDF5 library. You should recompile the application or check your shared library related settings such as 'LD_LIBRARY_PATH'. You can, at your own risk, disable this warning by setting the environment variable 'HDF5_DISABLE_VERSION_CHECK' to a value of '1'. Setting it to 2 or higher will suppress the warning messages totally. Headers are 1.10.4, library is 1.10.5 SUMMARY OF THE HDF5 CONFIGURATION

General Information:

               HDF5 Version: 1.10.5
              Configured on: Tue Oct 22 12:02:13 UTC 2019
              Configured by: conda@16247e67ecd5
                Host system: x86_64-conda_cos6-linux-gnu
          Uname information: Linux 16247e67ecd5 4.15.0-1059-azure #64-Ubuntu SMP Fri Sep 13 17:02:44 UTC 2019 x86_64 x86_64 x86_64 GNU/Linux
                   Byte sex: little-endian
         Installation point: /forebrain_organoids/fastq/zUMIs/zUMIs-env

Compiling Options:

                 Build Mode: production
          Debugging Symbols: no
                    Asserts: no
                  Profiling: no
         Optimization Level: high

Linking Options:

                  Libraries: static, shared

Statically Linked Executables: LDFLAGS: -Wl,-O2 -Wl,--sort-common -Wl,--as-needed -Wl,-z,relro -Wl,-z,now -Wl,--disable-new-dtags -Wl,--gc-sections -Wl,-rpath,/forebrain_organoids/fastq/zUMIs/zUMIs-env/lib -Wl,-rpath-link,/forebrain_organoids/fastq/zUMIs/zUMIs-env/lib -L/forebrain_organoids/fastq/zUMIs/zUMIs-env/lib H5_LDFLAGS: AM_LDFLAGS: -L/forebrain_organoids/fastq/zUMIs/zUMIs-env/lib Extra libraries: -lrt -lpthread -lz -ldl -lm Archiver: /home/conda/feedstock_root/build_artifacts/hdf5_split_1571745596770/_build_env/bin/x86_64-conda_cos6-linux-gnu-ar AR_FLAGS: cr Ranlib: /home/conda/feedstock_root/build_artifacts/hdf5_split_1571745596770/_build_env/bin/x86_64-conda_cos6-linux-gnu-ranlib

Languages:

                          C: yes
                 C Compiler: /home/conda/feedstock_root/build_artifacts/hdf5_split_1571745596770/_build_env/bin/x86_64-conda_cos6-linux-gnu-cc
                   CPPFLAGS: -DNDEBUG -D_FORTIFY_SOURCE=2 -O2 -I/forebrain_organoids/fastq/zUMIs/zUMIs-env/include
                H5_CPPFLAGS: -D_GNU_SOURCE -D_POSIX_C_SOURCE=200809L   -DNDEBUG -UH5_DEBUG_API
                AM_CPPFLAGS:  -I/forebrain_organoids/fastq/zUMIs/zUMIs-env/include
                    C Flags: -march=nocona -mtune=haswell -ftree-vectorize -fPIC -fstack-protector-strong -fno-plt -O2 -ffunction-sections -pipe -I/forebrain_organoids/fastq/zUMIs/zUMIs-env/include -fdebug-prefix-map=/home/conda/feedstock_root/build_artifacts/hdf5_split_1571745596770/work=/usr/local/src/conda/hdf5_split-1.10.5 -fdebug-prefix-map=/forebrain_organoids/fastq/zUMIs/zUMIs-env=/usr/local/src/conda-prefix
                 H5 C Flags:  -std=c99  -pedantic -Wall -Wextra -Wbad-function-cast -Wc++-compat -Wcast-align -Wcast-qual -Wconversion -Wdeclaration-after-statement -Wdisabled-optimization -Wfloat-equal -Wformat=2 -Winit-self -Winvalid-pch -Wmissing-declarations -Wmissing-include-dirs -Wmissing-prototypes -Wnested-externs -Wold-style-definition -Wpacked -Wpointer-arith -Wredundant-decls -Wshadow -Wstrict-prototypes -Wswitch-default -Wswitch-enum -Wundef -Wunused-macros -Wunsafe-loop-optimizations -Wwrite-strings -finline-functions -s -Wno-inline -Wno-aggregate-return -Wno-missing-format-attribute -Wno-missing-noreturn -O
                 AM C Flags: 
           Shared C Library: yes
           Static C Library: yes

                    Fortran: yes
           Fortran Compiler: /home/conda/feedstock_root/build_artifacts/hdf5_split_1571745596770/_build_env/bin/x86_64-conda_cos6-linux-gnu-gfortran
              Fortran Flags: 
           H5 Fortran Flags:  -pedantic -Wall -Wextra -Wunderflow -Wimplicit-interface -Wsurprising -Wno-c-binding-type  -s -O2
           AM Fortran Flags: 
     Shared Fortran Library: yes
     Static Fortran Library: yes

                        C++: yes
               C++ Compiler: /home/conda/feedstock_root/build_artifacts/hdf5_split_1571745596770/_build_env/bin/x86_64-conda_cos6-linux-gnu-c++
                  C++ Flags: -fvisibility-inlines-hidden -std=c++17 -fmessage-length=0 -march=nocona -mtune=haswell -ftree-vectorize -fPIC -fstack-protector-strong -fno-plt -O2 -ffunction-sections -pipe -I/forebrain_organoids/fastq/zUMIs/zUMIs-env/include -fdebug-prefix-map=/home/conda/feedstock_root/build_artifacts/hdf5_split_1571745596770/work=/usr/local/src/conda/hdf5_split-1.10.5 -fdebug-prefix-map=/forebrain_organoids/fastq/zUMIs/zUMIs-env=/usr/local/src/conda-prefix
               H5 C++ Flags:   -pedantic -Wall -W -Wundef -Wshadow -Wpointer-arith -Wcast-qual -Wcast-align -Wwrite-strings -Wconversion -Wredundant-decls -Winline -Wsign-promo -Woverloaded-virtual -Wold-style-cast -Weffc++ -Wreorder -Wnon-virtual-dtor -Wctor-dtor-privacy -Wabi -finline-functions -s -O
               AM C++ Flags: 
         Shared C++ Library: yes
         Static C++ Library: yes

                       Java: no

Features:

               Parallel HDF5: no

Parallel Filtered Dataset Writes: no Large Parallel I/O: no High-level library: yes Threadsafety: yes Default API mapping: v110 With deprecated public symbols: yes I/O filters (external): deflate(zlib) MPE: no Direct VFD: no dmalloc: no Packages w/ extra debug output: none API tracing: no Using memory checker: yes Memory allocation sanity checks: no Function stack tracing: no Strict file format checks: no Optimization instrumentation: no Bye... /forebrain_organoids/fastq/zUMIs/zUMIs.sh: line 307: 235719 Aborted ${Rexc} ${zumisdir}/misc/rds2loom.R ${yaml} Sun Nov 28 11:43:06 EST 2021 [1] "2021-11-28 11:43:06 EST" [1] "Preparing bam file for velocyto..."`

cziegenhain commented 2 years ago

Hi,

This is odd! Your YAML file looks ok on first glance. I can see that STAR doesnt seem to be getting the 125 bp cDNA bits, so that's why there is no mapping working.

Maybe something to do with unconventially formatted fastq headers? Could you send a few lines of your fastq file and the unmapped.bam file generated by zUMIs?

Best, Christoph

brain-discourse commented 2 years ago

Thank you for your response. Yes I agree. Here are the first few lines of the fastq file generated by zUMI

------> reads_for_zUMIs.R1.fastq.gz <------ @SRR13772724.1 700523F:292:CDN6UANXX:5:1101:10001:37914 length=126 GTCCCGTTCAGCTAGGGCAGGTGTCATCTTTCCAGTGGGGAGGCTGATGCGTTATCTGAAGAAAGGGACGTTCAAGTACCGGATCAGCGTGGGCGCCCCTGTCTACATGGCGGCAGTCATTGAGTA +SRR13772724.1 700523F:292:CDN6UANXX:5:1101:10001:37914 length=126 CCCCCGGGGCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGCFG>GGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGGEGGGGGGGGGC@EBGGGGGGG@ @SRR13772724.2 700523F:292:CDN6UANXX:5:1101:10004:87516 length=126 CCGGGGAACCCTTGATCCGTCGATCAGATGATAATGAAAAGGCCTTGAAAATCCGCCTGCAAGCCTACCACACTCAAACCACCCCACTCATAGAGTACTACAGGAAACGGGGGATCCACTCCGCCA +SRR13772724.2 700523F:292:CDN6UANXX:5:1101:10004:87516 length=126 CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG, @SRR13772724.3 700523F:292:CDN6UANXX:5:1101:10008:97511 length=126 GTAACAATAAAAGAAAATGTTTCTGGTACAGGACCAGCAGTACAAAAAAATAGTGTACGAGTACCTGGATAATACACCCGTTTTGCAATAGTGCAACTTTTAAGTACATATTGTTGACTGTCCATA +SRR13772724.3 700523F:292:CDN6UANXX:5:1101:10008:97511 length=126 CCCCCGFEGEGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGECEGGGGGGGGGGGGGGGGGFGGGGGGGGGFGGGGGGGF?FCGGGGGGGGGGGGGGGGGGGCGGGGGEGGGGGGGGG5 @SRR13772724.4 700523F:292:CDN6UANXX:5:1101:10022:57329 length=126 GTACATGGGCACTGCGATAGGAATCATGTCTGGTCGCGGCAAAGGCGGAAAAGGCTTGGGGAAGGGTGGTGCTAAGCGCCATCGTAAGGTGCTCCGGGATAACATCCAGGGCATTACAAAACCGGC +SRR13772724.4 700523F:292:CDN6UANXX:5:1101:10022:57329 length=126 CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGFGGGGGGGGGGGGGGGGGG@GGGGGDGEGGGGGGGGGDGGGGGEGGGGGGGGEGGG=G=>EDGG8 @SRR13772724.5 700523F:292:CDN6UANXX:5:1101:10028:93745 length=126 GTTTTTCAGTGGGTTCTTCTTTAGGACTCTGCGATGGATCTTCTTGCGTGGTGCTCGAAGGGCTCTTTGGATCTCTGGGCTTTTCAAGATTCTGCTAAGATCTGTATTAATCATCTTGTGCATGGG +SRR13772724.5 700523F:292:CDN6UANXX:5:1101:10028:93745 length=126 CCCCCGGGGGGGGGGGGGGGGGGGFFGGFGGGGGGGGGGGGGGGGGGGGGDGGGGGGD@DEBBEGGGGGGGGEGGGGGGGGGGGGGGGGGGGGCCGG@CGGGCCG>C>C8D<@FCGGGFCGFGG-; @SRR13772724.6 700523F:292:CDN6UANXX:5:1101:10031:10941 length=126 GTACATGGGGAACCCAGTGGTAGGGACAAGACCAGAGTTCATGTCGATCTTGGGAATGCCATGAATTTCTCCTGCAGGAGAAATCACTTAACTTTTTCAACTGTATCAGTAGTACCGTATTTTGTA +SRR13772724.6 700523F:292:CDN6UANXX:5:1101:10031:10941 length=126 CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCFFCGGGGGGEGGGGGGGGGGGGGGGGGGGGCG/ @SRR13772724.7 700523F:292:CDN6UANXX:5:1101:10032:41672 length=126 GCCACCAAAGCCACCACGACCACTGAAGTTTCCTCCACGACCGAAGTTGTCATTCCCACCGAAACCACCTCCACGACCACCACCAAAGTTTCCAGAACCACTTCGACCTCTTTGGCTGGATGAAGC +SRR13772724.7 700523F:292:CDN6UANXX:5:1101:10032:41672 length=126 CCCCCGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG @SRR13772724.8 700523F:292:CDN6UANXX:5:1101:10034:80048 length=126

Here are the first few lines of the unmapped.bam file generated by zUMIs SRR13772724.1 700523F:292:CDN6UANXX:5:1101:10001:37914 4 * 0 0 * * 0 0 GTCCCGTTCAGCTAGGGCAGGTGTCATCTTTCCAGTGGGGAGGCTGATGCGTTATCTGAAGAAAGGGACGTTCAAGTACCGGATCAGCGTGGGCGCCCCTGTCTACATGGCGGCAGTCATTGAGT CCCCCGGGGCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGCFG>GGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGGEGGGGGGGGGC@EBGGGGGGG BC:Z:LRUMXBID UB:Z: QB:Z:AAAAAAAA QU:Z: SRR13772724.2 700523F:292:CDN6UANXX:5:1101:10004:87516 4 * 0 0 * * 0 0 CCGGGGAACCCTTGATCCGTCGATCAGATGATAATGAAAAGGCCTTGAAAATCCGCCTGCAAGCCTACCACACTCAAACCACCCCACTCATAGAGTACTACAGGAAACGGGGGATCCACTCCGCC CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG BC:Z:LRUMXBID UB:Z: QB:Z:AAAAAAAA QU:Z: SRR13772724.3 700523F:292:CDN6UANXX:5:1101:10008:97511 4 * 0 0 * * 0 0 GTAACAATAAAAGAAAATGTTTCTGGTACAGGACCAGCAGTACAAAAAAATAGTGTACGAGTACCTGGATAATACACCCGTTTTGCAATAGTGCAACTTTTAAGTACATATTGTTGACTGTCCAT CCCCCGFEGEGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGECEGGGGGGGGGGGGGGGGGFGGGGGGGGGFGGGGGGGF?FCGGGGGGGGGGGGGGGGGGGCGGGGGEGGGGGGGGG BC:Z:LRUMXBID UB:Z: QB:Z:AAAAAAAA QU:Z: SRR13772724.4 700523F:292:CDN6UANXX:5:1101:10022:57329 4 * 0 0 * * 0 0 GTACATGGGCACTGCGATAGGAATCATGTCTGGTCGCGGCAAAGGCGGAAAAGGCTTGGGGAAGGGTGGTGCTAAGCGCCATCGTAAGGTGCTCCGGGATAACATCCAGGGCATTACAAAACCGG CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGFGGGGGGGGGGGGGGGGGG@GGGGGDGEGGGGGGGGGDGGGGGEGGGGGGGGEGGG=G=>EDGG BC:Z:LRUMXBID UB:Z: QB:Z:AAAAAAAA QU:Z: SRR13772724.5 700523F:292:CDN6UANXX:5:1101:10028:93745 4 * 0 0 * * 0 0 GTTTTTCAGTGGGTTCTTCTTTAGGACTCTGCGATGGATCTTCTTGCGTGGTGCTCGAAGGGCTCTTTGGATCTCTGGGCTTTTCAAGATTCTGCTAAGATCTGTATTAATCATCTTGTGCATGG CCCCCGGGGGGGGGGGGGGGGGGGFFGGFGGGGGGGGGGGGGGGGGGGGGDGGGGGGD@DEBBEGGGGGGGGEGGGGGGGGGGGGGGGGGGGGCCGG@CGGGCCG>C>C8D<@FCGGGFCGFGG- BC:Z:LRUMXBID UB:Z: QB:Z:AAAAAAAA QU:Z: SRR13772724.6 700523F:292:CDN6UANXX:5:1101:10031:10941 4 * 0 0 * * 0 0 GTACATGGGGAACCCAGTGGTAGGGACAAGACCAGAGTTCATGTCGATCTTGGGAATGCCATGAATTTCTCCTGCAGGAGAAATCACTTAACTTTTTCAACTGTATCAGTAGTACCGTATTTTGT CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCFFCGGGGGGEGGGGGGGGGGGGGGGGGGGGCG BC:Z:LRUMXBID UB:Z: QB:Z:AAAAAAAA QU:Z: SRR13772724.7 700523F:292:CDN6UANXX:5:1101:10032:41672 4 * 0 0 * * 0 0 GCCACCAAAGCCACCACGACCACTGAAGTTTCCTCCACGACCGAAGTTGTCATTCCCACCGAAACCACCTCCACGACCACCACCAAAGTTTCCAGAACCACTTCGACCTCTTTGGCTGGATGAAG CCCCCGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG BC:Z:LRUMXBID UB:Z: QB:Z:AAAAAAAA QU:Z: SRR13772724.8 700523F:292:CDN6UANXX:5:1101:10034:80048 4 * 0 0 * * 0 0 CCCACATCCCATCCCCCTCACCACTGTGCAGTGTGTATGCAGTTTGTGCGAAAGGAAAACCTACTCTCTCTGGCCTGTCAGCACCAGTTTTGCCGCAGCTGCTGGGAGCAGCACTGCTCAGTTCT CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG BC:Z:LRUMXBID UB:Z: QB:Z:AAAAAAAA QU:Z: SRR13772724.9 700523F:292:CDN6UANXX:5:1101:10051:86583 4 * 0 0 * * 0 0 TCCATGTGCAGAGTAACGGTCCAAACCAGTGCTGTGGTCCCTGGTGCCCGGGTAGTGGTCCAGATTCTCTTTATTCATCTTCGTAGCCAGTTGGAAGTGGATTCACATGAGGGTTATGGAATAGA B?ABBGGGGGGGGGGGGDGGGGGGGGGGBGGGGGGGGGGGBGGEGGGGGGAGG<FGGGGGGGGGGGGGGGGGGGGEGGGGGGGFGGGGCGGGC>=CGGEGG>FGEGEGGFGGGGGGGG=FGFGGG BC:Z:LRUMXBID UB:Z: QB:Z:AAAAAAAA QU:Z: SRR13772724.10 700523F:292:CDN6UANXX:5:1101:10052:38619 4 * 0 0 * * 0 0 GGGTTTTGGATGCCTTCTTTAGGATCCTTTCCATTTGCCGCTTCTCCTGCATTTTCTCGAAGGCCGCCTGGGCCGGGGTCCGCTTGTCCAGGCCGCGCCGCTTCTCCTCCTCGTTCTTTTTGCTC CCCCCFGGGGGGGGGGGGGGGGGEGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGBFFGGGGGGGGGGGEEGGGGGGGGGGGGGG=GEGGGGGGGGGGGGGGGGGGGGGG;EB<EGG==.=,5BE BC:Z:LRUMXBID UB:Z: QB:Z:AAAAAAAA QU:Z: SRR13772724.11 700523F:292:CDN6UANXX:5:1101:10052:51624 4 * 0 0 * * 0 0 TGATAGTTCTGGCTGCCCTTCACCTCTGGGTGGGCCCGAGGACTTCTAGGAACTTGTTTTATCAGTGACCATCTCTGTAGTTCAGTTAACACTTTACTCCCAACTTGCTTCATCATTGCTATTGC BBBBBGFGFG;;BF>CEGEGFFFGFDF@>FF<EGGGGGGGGGGFGEFFFCCGGGGGGGGGGGFGFFFGGECGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGEGGEGGGGGCGCGGGCF BC:Z:LRUMXBID UB:Z: QB:Z:AAAAAAAA QU:Z: SRR13772724.12 700523F:292:CDN6UANXX:5:1101:10055:85774 4 * 0 0 * * 0 0 GTGCAGTACCACTGAGGACTGTTGCTGTATTGATTAGGAAAAGAGACAGAGTAATTTGCAGTTTGTTTGATTTATACTTTTGTTTATCTACAACCCAATAACAGACATGAGGGATGGCCCTGTCT CCCCCGGGGGGGGGGGEGEGGGGGGGGGFGEEGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGGGGGGGG@FGGGGGGFGGGGFGG0CFEGCFGGGGG/:FFFGGGGGGGEGGG BC:Z:LRUMXBID UB:Z: QB:Z:AAAAAAAA QU:Z:

cziegenhain commented 2 years ago

Hmm yes I suspected this! The issue is probably because of the unexpected whitespace in the read IDs Try the following instructions: https://github.com/sdparekh/zUMIs/wiki/Reprocessing-of-public-data

brain-discourse commented 2 years ago

I am still having alignment issues after following the instructions in the link.

Here is the error I am getting: `Using miniconda environment for zUMIs! note: internal executables will be used instead of those specified in the YAML file!

You provided these parameters: YAML file: /forebrain_organoids/fastq/zUMI_auto_ss2.yaml zUMIs directory: /forebrain_organoids/fastq/zUMIs STAR executable STAR samtools executable samtools pigz executable pigz Rscript executable Rscript RAM limit: 100 zUMIs version 2.9.7

Mon Dec 6 21:15:38 EST 2021 WARNING: The STAR version used for mapping is 2.7.3a and the STAR index was created using the version 2.7.1a. This may lead to an error while mapping. If you encounter any errors at the mapping stage, please make sure to create the STAR index using STAR 2.7.3a. Filtering... Mon Dec 6 21:42:07 EST 2021 Registered S3 methods overwritten by 'ggplot2': method from [.quosures rlang c.quosures rlang print.quosures rlang [1] " reads were assigned to barcodes that do not correspond to intact cells." Mapping... [1] "2021-12-06 21:42:09 EST" Dec 06 21:42:15 ..... started STAR run Dec 06 21:42:19 ..... loading genome Dec 06 21:42:15 ..... started STAR run Dec 06 21:42:19 ..... loading genome Dec 06 21:42:15 ..... started STAR run Dec 06 21:42:19 ..... loading genome Dec 06 21:43:41 ..... processing annotations GTF Dec 06 21:44:15 ..... inserting junctions into the genome indices Dec 06 21:46:31 ..... processing annotations GTF Dec 06 21:49:06 ..... processing annotations GTF Dec 06 21:51:19 ..... inserting junctions into the genome indices Dec 06 21:56:48 ..... inserting junctions into the genome indices Dec 06 22:49:50 ..... started mapping Dec 06 22:58:45 ..... started mapping Dec 06 23:10:24 ..... started mapping Dec 06 23:32:39 ..... finished mapping Dec 06 23:32:55 ..... finished successfully sh: line 1: 295437 Killed STAR --readFilesCommand samtools view -@ 2 --outSAMmultNmax 1 --outFilterMultimapNmax 50 --outSAMunmapped Within --outSAMtype BAM Unsorted --quantMode TranscriptomeSAM --genomeDir /scrnaseq/hg38_STAR5idx --sjdbGTFfile /scrnaseq/Homo_sapiens.GRCh38.99.gtf --runThreadN 16 --sjdbOverhang 124 --readFilesType SAM SE --readFilesIn /forebrain_organoids/fastq/zUMIs_output/.tmpMerge//Smartseq2_organoid.Smartseq2_organoidaq.filtered.tagged.bam,/forebrain_organoids/fastq/zUMIs_output/.tmpMerge//Smartseq2_organoid.Smartseq2_organoidar.filtered.tagged.bam,/forebrain_organoids/fastq/zUMIs_output/.tmpMerge//Smartseq2_organoid.Smartseq2_organoidas.filtered.tagged.bam,/forebrain_organoids/fastq/zUMIs_output/.tmpMerge//Smartseq2_organoid.Smartseq2_organoidat.filtered.tagged.bam,/forebrain_organoids/fastq/zUMIs_output/.tmpMerge//Smartseq2_organoid.Smartseq2_organoidau.filtered.tagged.bam,/forebrain_organoids/fastq/zUMIs_output/.tmpMerge//Smartseq2_organoid.Smartseq2_organoidav.filtered.tagged.bam,/forebrain_organoids/fastq/zUMIs_output/.tmpMerge//Smartseq2_organoid.Smartseq2_organoidaw.filtered.tagged.bam,/forebrain_organoids/fastq/zUMIs_output/.tmpMerge//Smartseq2_organoid.Smartseq2_organoidax.filtered.tagged.bam,/forebrain_organoids/fastq/zUMIs_output/.tmpMerge//Smartseq2_organoid.Smartseq2_organoiday.filtered.tagged.bam,/forebrain_organoids/fastq/zUMIs_output/.tmpMerge//Smartseq2_organoid.Smartseq2_organoidaz.filtered.tagged.bam,/forebrain_organoids/fastq/zUMIs_output/.tmpMerge//Smartseq2_organoid.Smartseq2_organoidba.filtered.tagged.bam,/forebrain_organoids/fastq/zUMIs_output/.tmpMerge//Smartseq2_organoid.Smartseq2_organoidbb.filtered.tagged.bam,/forebrain_organoids/fastq/zUMIs_output/.tmpMerge//Smartseq2_organoid.Smartseq2_organoidbc.filtered.tagged.bam,/forebrain_organoids/fastq/zUMIs_output/.tmpMerge//Smartseq2_organoid.Smartseq2_organoidbd.filtered.tagged.bam,/forebrain_organoids/fastq/zUMIs_output/.tmpMerge//Smartseq2_organoid.Smartseq2_organoidbe.filtered.tagged.bam,/forebrain_organoids/fastq/zUMIs_output/.tmpMerge//Smartseq2_organoid.Smartseq2_organoidbf.filtered.tagged.bam --outFileNamePrefix /forebrain_organoids/fastq/zUMIs_output/.tmpMap//tmp.Smartseq2_organoid.2. Dec 06 23:34:06 ..... finished mapping Dec 06 23:34:10 ..... finished successfully [W::bam_hdr_read] EOF marker is absent. The input is probably truncated [W::bam_hdr_read] EOF marker is absent. The input is probably truncated [bam_cat] WARNING: Unexpected block structure in file '/forebrain_organoids/fastq/zUMIs_output/.tmpMap//tmp.Smartseq2_organoid.2.Aligned.out.bam'. Possible output corruption. [bam_cat] WARNING: Unexpected block structure in file '/forebrain_organoids/fastq/zUMIs_output/.tmpMap//tmp.Smartseq2_organoid.2.Aligned.toTranscriptome.out.bam'. Possible output corruption. Mon Dec 6 23:34:28 EST 2021`

The first few lines of the fasta file ------> reads_for_zUMIs.R1.fastq.gz <------ @700523F:292:CDN6UANXX:5:1101:10001:37914 GTCCCGTTCAGCTAGGGCAGGTGTCATCTTTCCAGTGGGGAGGCTGATGCGTTATCTGAAGAAAGGGACGTTCAAGTACCGGATCAGCGTGGGCGCCCCTGTCTACATGGCGGCAGTCATTGAGTA + CCCCCGGGGCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGCFG>GGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGGEGGGGGGGGGC@EBGGGGGGG@ @700523F:292:CDN6UANXX:5:1101:10004:87516 CCGGGGAACCCTTGATCCGTCGATCAGATGATAATGAAAAGGCCTTGAAAATCCGCCTGCAAGCCTACCACACTCAAACCACCCCACTCATAGAGTACTACAGGAAACGGGGGATCCACTCCGCCA + CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG, @700523F:292:CDN6UANXX:5:1101:10008:97511 GTAACAATAAAAGAAAATGTTTCTGGTACAGGACCAGCAGTACAAAAAAATAGTGTACGAGTACCTGGATAATACACCCGTTTTGCAATAGTGCAACTTTTAAGTACATATTGTTGACTGTCCATA + CCCCCGFEGEGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGECEGGGGGGGGGGGGGGGGGFGGGGGGGGGFGGGGGGGF?FCGGGGGGGGGGGGGGGGGGGCGGGGGEGGGGGGGGG5 @700523F:292:CDN6UANXX:5:1101:10022:57329 GTACATGGGCACTGCGATAGGAATCATGTCTGGTCGCGGCAAAGGCGGAAAAGGCTTGGGGAAGGGTGGTGCTAAGCGCCATCGTAAGGTGCTCCGGGATAACATCCAGGGCATTACAAAACCGGC + CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGFGGGGGGGGGGGGGGGGGG@GGGGGDGEGGGGGGGGGDGGGGGEGGGGGGGGEGGG=G=>EDGG8 @700523F:292:CDN6UANXX:5:1101:10028:93745 GTTTTTCAGTGGGTTCTTCTTTAGGACTCTGCGATGGATCTTCTTGCGTGGTGCTCGAAGGGCTCTTTGGATCTCTGGGCTTTTCAAGATTCTGCTAAGATCTGTATTAATCATCTTGTGCATGGG +

the first few lines of the unmapped bam file: 700523F:292:CDN6UANXX:5:1101:10001:37914 4 * 0 0 * * 0 0 GTCCCGTTCAGCTAGGGCAGGTGTCATCTTTCCAGTGGGGAGGCTGATGCGTTATCTGAAGAAAGGGACGTTCAAGTACCGGATCAGCGTGGGCGCCCCTGTCTACATGGCGGCAGTCATTGAGT CCCCCGGGGCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGCFG>GGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGGEGGGGGGGGGC@EBGGGGGGG BC:Z:VWTRKSUT UB:Z: QB:Z:AAAAAAAA QU:Z: 700523F:292:CDN6UANXX:5:1101:10004:87516 4 * 0 0 * * 0 0 CCGGGGAACCCTTGATCCGTCGATCAGATGATAATGAAAAGGCCTTGAAAATCCGCCTGCAAGCCTACCACACTCAAACCACCCCACTCATAGAGTACTACAGGAAACGGGGGATCCACTCCGCC CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG BC:Z:VWTRKSUT UB:Z: QB:Z:AAAAAAAA QU:Z: 700523F:292:CDN6UANXX:5:1101:10008:97511 4 * 0 0 * * 0 0 GTAACAATAAAAGAAAATGTTTCTGGTACAGGACCAGCAGTACAAAAAAATAGTGTACGAGTACCTGGATAATACACCCGTTTTGCAATAGTGCAACTTTTAAGTACATATTGTTGACTGTCCAT CCCCCGFEGEGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGECEGGGGGGGGGGGGGGGGGFGGGGGGGGGFGGGGGGGF?FCGGGGGGGGGGGGGGGGGGGCGGGGGEGGGGGGGGG BC:Z:VWTRKSUT UB:Z: QB:Z:AAAAAAAA QU:Z: 700523F:292:CDN6UANXX:5:1101:10022:57329 4 * 0 0 * * 0 0 GTACATGGGCACTGCGATAGGAATCATGTCTGGTCGCGGCAAAGGCGGAAAAGGCTTGGGGAAGGGTGGTGCTAAGCGCCATCGTAAGGTGCTCCGGGATAACATCCAGGGCATTACAAAACCGG CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGFGGGGGGGGGGGGGGGGGG@GGGGGDGEGGGGGGGGGDGGGGGEGGGGGGGGEGGG=G=>EDGG BC:Z:VWTRKSUT UB:Z: QB:Z:AAAAAAAA QU:Z: 700523F:292:CDN6UANXX:5:1101:10028:93745 4 * 0 0 * * 0 0 GTTTTTCAGTGGGTTCTTCTTTAGGACTCTGCGATGGATCTTCTTGCGTGGTGCTCGAAGGGCTCTTTGGATCTCTGGGCTTTTCAAGATTCTGCTAAGATCTGTATTAATCATCTTGTGCATGG CCCCCGGGGGGGGGGGGGGGGGGGFFGGFGGGGGGGGGGGGGGGGGGGGGDGGGGGGD@DEBBEGGGGGGGGEGGGGGGGGGGGGGGGGGGGGCCGG@CGGGCCG>C>C8D<@FCGGGFCGFGG- BC:Z:VWTRKSUT UB:Z: QB:Z:AAAAAAAA QU:Z: 700523F:292:CDN6UANXX:5:1101:10031:10941 4 * 0 0 * * 0 0 GTACATGGGGAACCCAGTGGTAGGGACAAGACCAGAGTTCATGTCGATCTTGGGAATGCCATGAATTTCTCCTGCAGGAGAAATCACTTAACTTTTTCAACTGTATCAGTAGTACCGTATTTTGT CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCFFCGGGGGGEGGGGGGGGGGGGGGGGGGGGCG BC:Z:VWTRKSUT UB:Z: QB:Z:AAAAAAAA QU:Z: 700523F:292:CDN6UANXX:5:1101:10032:41672 4 * 0 0 * * 0 0 GCCACCAAAGCCACCACGACCACTGAAGTTTCCTCCACGACCGAAGTTGTCATTCCCACCGAAACCACCTCCACGACCACCACCAAAGTTTCCAGAACCACTTCGACCTCTTTGGCTGGATGAAG CCCCCGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG BC:Z:VWTRKSUT UB:Z: QB:Z:AAAAAAAA QU:Z: 700523F:292:CDN6UANXX:5:1101:10034:80048 4 * 0 0 * * 0 0 CCCACATCCCATCCCCCTCACCACTGTGCAGTGTGTATGCAGTTTGTGCGAAAGGAAAACCTACTCTCTCTGGCCTGTCAGCACCAGTTTTGCCGCAGCTGCTGGGAGCAGCACTGCTCAGTTCT CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG BC:Z:VWTRKSUT UB:Z: QB:Z:AAAAAAAA QU:Z: 700523F:292:CDN6UANXX:5:1101:10051:86583 4 * 0 0 * * 0 0 TCCATGTGCAGAGTAACGGTCCAAACCAGTGCTGTGGTCCCTGGTGCCCGGGTAGTGGTCCAGATTCTCTTTATTCATCTTCGTAGCCAGTTGGAAGTGGATTCACATGAGGGTTATGGAATAGA B?ABBGGGGGGGGGGGGDGGGGGGGGGGBGGGGGGGGGGGBGGEGGGGGGAGG<FGGGGGGGGGGGGGGGGGGGGEGGGGGGGFGGGGCGGGC>=CGGEGG>FGEGEGGFGGGGGGGG=FGFGGG BC:Z:VWTRKSUT UB:Z: QB:Z:AAAAAAAA QU:Z: 700523F:292:CDN6UANXX:5:1101:10052:38619 4 * 0 0 * * 0 0 GGGTTTTGGATGCCTTCTTTAGGATCCTTTCCATTTGCCGCTTCTCCTGCATTTTCTCGAAGGCCGCCTGGGCCGGGGTCCGCTTGTCCAGGCCGCGCCGCTTCTCCTCCTCGTTCTTTTTGCTC CCCCCFGGGGGGGGGGGGGGGGGEGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGBFFGGGGGGGGGGGEEGGGGGGGGGGGGGG=GEGGGGGGGGGGGGGGGGGGGGGG;EB<EGG==.=,5BE BC:Z:VWTRKSUT UB:Z: QB:Z:AAAAAAAA QU:Z: 700523F:292:CDN6UANXX:5:1101:10052:51624 4 * 0 0 * * 0 0 TGATAGTTCTGGCTGCCCTTCACCTCTGGGTGGGCCCGAGGACTTCTAGGAACTTGTTTTATCAGTGACCATCTCTGTAGTTCAGTTAACACTTTACTCCCAACTTGCTTCATCATTGCTATTGC BBBBBGFGFG;;BF>CEGEGFFFGFDF@>FF<EGGGGGGGGGGFGEFFFCCGGGGGGGGGGGFGFFFGGECGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGEGGEGGGGGCGCGGGCF BC:Z:VWTRKSUT UB:Z: QB:Z:AAAAAAAA QU:Z: 700523F:292:CDN6UANXX:5:1101:10055:85774 4 * 0 0 * * 0 0 GTGCAGTACCACTGAGGACTGTTGCTGTATTGATTAGGAAAAGAGACAGAGTAATTTGCAGTTTGTTTGATTTATACTTTTGTTTATCTACAACCCAATAACAGACATGAGGGATGGCCCTGTCT CCCCCGGGGGGGGGGGEGEGGGGGGGGGFGEEGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGGGGGGGG@FGGGGGGFGGGGFGG0CFEGCFGGGGG/:FFFGGGGGGGEGGG BC:Z:VWTRKSUT UB:Z: QB:Z:AAAAAAAA QU:Z: 700523F:292:CDN6UANXX:5:1101:10060:35761 4 * 0 0 * * 0 0 GGACCCTAGTCTTCCAAGTTCGGAATGTGTGTGGCCCATGGAACTTCTGGGCAGCCGCCTATCGGCTCCGGGAGAGGAAAGACCCGGACGCCTTATTTCCTTTTCTTGGGTTTATACTCTTGGGA CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG BC:Z:VWTRKSUT UB:Z: QB:Z:AAAAAAAA QU:Z: 700523F:292:CDN6UANXX:5:1101:10071:34986 4 * 0 0 * * 0 0 CCACAATGGTGCGCATGAATGTCCTGGCAGATGCTCTCAAGAGTATCAACAATGCCGAAAAGAGAGGCAAACGCCAGGTGCTTATTAGGCCGTGCTCCAAAGTCATCGTCCGGTTTCTCACTGTG CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGGGG BC:Z:VWTRKSUT UB:Z: QB:Z:AAAAAAAA QU:Z: 700523F:292:CDN6UANXX:5:1101:10079:79294 4 * 0 0 * * 0 0 AGTCTTAGCATGTACTGCTCGGAGGTTGGGTTCTGCTCCGAGGTCGCCCCAACCGAAATTTTTAATGCAGGTTTGGTAGTTTAGGACCTGTGGGTTTGTTAGGTACTGTTTGCATTAATAAATTA CCCCCFGGGGGGGGGGG>DGFGGGGGGGGGGGGGGGGEGGGGGGGGGGGGGBGGGGGAGGFGEGGGGGGEGGEGGGGGGGGGGGGGGGGGGFFGGBDGGGCGEEBEGGGGGGGGEGEGGGGGGEG BC:Z:VWTRKSUT UB:Z: QB:Z:AAAAAAAA QU:Z:

cziegenhain commented 2 years ago

The reads look good and it probably seems to be mapping alright now. I can see that one of the STAR jobs was killed on your system: Killed STAR ... Hence the downstream errors of broken files. Check that you have enough RAM, CPU & free disk space available.

brain-discourse commented 2 years ago

Thank you for helping out with this. The STAR step seems to work but I am having trouble with velocyto now. I dont have anything in my *.tagged.forVelocyto.bam file. Is this because of the HDF5 error? Also, I was wondering if there is any way to normalize the read counts to mitochondrial reads?

Here is the zUMIs log file: `Using miniconda environment for zUMIs! note: internal executables will be used instead of those specified in the YAML file!

You provided these parameters: YAML file: /forebrain_organoids/fastq/zUMI_auto_ss2.yaml zUMIs directory: /forebrain_organoids/fastq/zUMIs STAR executable STAR samtools executable samtools pigz executable pigz Rscript executable Rscript RAM limit: 100 zUMIs version 2.9.7

Wed Dec 8 16:38:07 EST 2021 WARNING: The STAR version used for mapping is 2.7.3a and the STAR index was created using the version 2.7.1a. This may lead to an error while mapping. If you encounter any errors at the mapping stage, please make sure to create the STAR index using STAR 2.7.3a. Filtering... Wed Dec 8 17:11:23 EST 2021 Registered S3 methods overwritten by 'ggplot2': method from [.quosures rlang c.quosures rlang print.quosures rlang [1] " reads were assigned to barcodes that do not correspond to intact cells." Mapping... [1] "2021-12-08 17:11:26 EST" Dec 08 17:11:31 ..... started STAR run Dec 08 17:11:34 ..... loading genome Dec 08 17:11:31 ..... started STAR run Dec 08 17:11:35 ..... loading genome Dec 08 17:11:31 ..... started STAR run Dec 08 17:11:35 ..... loading genome Dec 08 17:12:46 ..... processing annotations GTF Dec 08 17:13:17 ..... processing annotations GTF Dec 08 17:13:26 ..... processing annotations GTF Dec 08 17:13:38 ..... inserting junctions into the genome indices Dec 08 17:17:46 ..... inserting junctions into the genome indices Dec 08 17:19:07 ..... inserting junctions into the genome indices Dec 08 17:59:55 ..... started mapping Dec 08 18:03:04 ..... started mapping Dec 08 18:03:50 ..... started mapping Dec 08 18:29:51 ..... finished mapping Dec 08 18:29:54 ..... finished successfully Dec 08 18:31:25 ..... finished mapping Dec 08 18:31:26 ..... finished mapping Dec 08 18:31:26 ..... finished successfully Dec 08 18:31:26 ..... finished successfully Wed Dec 8 18:31:39 EST 2021 Counting... Registered S3 methods overwritten by 'ggplot2': method from [.quosures rlang c.quosures rlang print.quosures rlang [1] "2021-12-08 18:31:53 EST" [1] "4.5e+08 Reads per chunk" [1] "Loading reference annotation from:" [1] "/forebrain_organoids/fastq/Smartseq2_organoid.final_annot.gtf" [1] "Annotation loaded!" Warning message: as_quosure() requires an explicit environment as of rlang 0.3.0. Please supply env. This warning is displayed once per session. [1] "Assigning reads to features (ex)"

    ==========     _____ _    _ ____  _____  ______          _____  
    =====         / ____| |  | |  _ \|  __ \|  ____|   /\   |  __ \ 
      =====      | (___ | |  | | |_) | |__) | |__     /  \  | |  | |
        ====      \___ \| |  | |  _ <|  _  /|  __|   / /\ \ | |  | |
          ====    ____) | |__| | |_) | | \ \| |____ / ____ \| |__| |
    ==========   |_____/ \____/|____/|_|  \_\______/_/    \_\_____/
   Rsubread 1.32.4
//========================== featureCounts setting ===========================\ Input files : 1 BAM file S Smartseq2_organoid.filtered.tagged.Aligned ...
Annotation : R data.frame
Assignment details : .featureCounts.bam
(Note that files are saved to the output directory)
Dir for temp files : .
Threads : 50
Level : meta-feature level
Paired-end : yes
Multimapping reads : counted
Multiple alignments : primary alignment only
Multi-overlapping reads : not counted
Min overlapping bases : 1
Chimeric reads : not counted
Both ends mapped : not required

\===================== http://subread.sourceforge.net/ ======================//

//================================= Running ==================================\ Load annotation file .Rsubread_UserProvidedAnnotation_pid83902 ... Features : 349261 Meta-features : 60676 Chromosomes/contigs : 47
Process BAM file Smartseq2_organoid.filtered.tagged.Aligned.out.bam...
Single-end reads are included.
Assign alignments to features...
Total alignments : 19394367
Successfully assigned alignments : 13853355 (71.4%)
Running time : 3.55 minutes

\===================== http://subread.sourceforge.net/ ======================//

[1] "Assigning reads to features (in)"

    ==========     _____ _    _ ____  _____  ______          _____  
    =====         / ____| |  | |  _ \|  __ \|  ____|   /\   |  __ \ 
      =====      | (___ | |  | | |_) | |__) | |__     /  \  | |  | |
        ====      \___ \| |  | |  _ <|  _  /|  __|   / /\ \ | |  | |
          ====    ____) | |__| | |_) | | \ \| |____ / ____ \| |__| |
    ==========   |_____/ \____/|____/|_|  \_\______/_/    \_\_____/
   Rsubread 1.32.4
//========================== featureCounts setting ===========================\ Input files : 1 BAM file S Smartseq2_organoid.filtered.tagged.Aligned ...
Annotation : R data.frame
Assignment details : .featureCounts.bam
(Note that files are saved to the output directory)
Dir for temp files : .
Threads : 50
Level : meta-feature level
Paired-end : yes
Multimapping reads : counted
Multiple alignments : primary alignment only
Multi-overlapping reads : not counted
Min overlapping bases : 1
Chimeric reads : not counted
Both ends mapped : not required

\===================== http://subread.sourceforge.net/ ======================//

//================================= Running ==================================\ Load annotation file .Rsubread_UserProvidedAnnotation_pid83902 ... Features : 240693 Meta-features : 28409 Chromosomes/contigs : 34
Process BAM file Smartseq2_organoid.filtered.tagged.Aligned.out.bam.ex ...
Single-end reads are included.
Assign alignments to features...
Total alignments : 19394367
Successfully assigned alignments : 1921946 (9.9%)
Running time : 3.53 minutes

\===================== http://subread.sourceforge.net/ ======================//

[1] "2021-12-08 18:54:16 EST" [1] "Coordinate sorting final bam file..." [bam_sort_core] merging from 0 files and 50 in-memory blocks... [1] "2021-12-08 18:57:22 EST" [1] "Here are the detected subsampling options:" [1] "Automatic downsampling" [1] "Working on barcode chunk 1 out of 1" [1] "Processing 50 barcodes in this chunk..." [1] "2021-12-08 19:04:54 EST" [1] "I am done!! Look what I produced.../forebrain_organoids/fastq/zUMIs_output/" used (Mb) gc trigger (Mb) max used (Mb) Ncells 7208492 385.0 24005852 1282.1 30007315 1602.6 Vcells 94021385 717.4 243237576 1855.8 243137155 1855.0 Wed Dec 8 19:04:57 EST 2021 Loading required package: yaml Loading required package: Matrix [1] "loomR found" Warning! HDF5 library version mismatched error The HDF5 header files used to compile this application do not match the version used by the HDF5 library to which this application is linked. Data corruption or segmentation faults may occur if the application continues. This can happen when an application was compiled by one version of HDF5 but linked with a different version of static or shared HDF5 library. You should recompile the application or check your shared library related settings such as 'LD_LIBRARY_PATH'. You can, at your own risk, disable this warning by setting the environment variable 'HDF5_DISABLE_VERSION_CHECK' to a value of '1'. Setting it to 2 or higher will suppress the warning messages totally. Headers are 1.10.4, library is 1.10.5 SUMMARY OF THE HDF5 CONFIGURATION

General Information:

               HDF5 Version: 1.10.5
              Configured on: Tue Oct 22 12:02:13 UTC 2019
              Configured by: conda@16247e67ecd5
                Host system: x86_64-conda_cos6-linux-gnu
          Uname information: Linux 16247e67ecd5 4.15.0-1059-azure #64-Ubuntu SMP Fri Sep 13 17:02:44 UTC 2019 x86_64 x86_64 x86_64 GNU/Linux
                   Byte sex: little-endian
         Installation point: /forebrain_organoids/fastq/zUMIs/zUMIs-env

Compiling Options:

                 Build Mode: production
          Debugging Symbols: no
                    Asserts: no
                  Profiling: no
         Optimization Level: high

Linking Options:

                  Libraries: static, shared

Statically Linked Executables: LDFLAGS: -Wl,-O2 -Wl,--sort-common -Wl,--as-needed -Wl,-z,relro -Wl,-z,now -Wl,--disable-new-dtags -Wl,--gc-sections -Wl,-rpath,/forebrain_organoids/fastq/zUMIs/zUMIs-env/lib -Wl,-rpath-link,/forebrain_organoids/fastq/zUMIs/zUMIs-env/lib -L/forebrain_organoids/fastq/zUMIs/zUMIs-env/lib H5_LDFLAGS: AM_LDFLAGS: -L/forebrain_organoids/fastq/zUMIs/zUMIs-env/lib Extra libraries: -lrt -lpthread -lz -ldl -lm Archiver: /home/conda/feedstock_root/build_artifacts/hdf5_split_1571745596770/_build_env/bin/x86_64-conda_cos6-linux-gnu-ar AR_FLAGS: cr Ranlib: /home/conda/feedstock_root/build_artifacts/hdf5_split_1571745596770/_build_env/bin/x86_64-conda_cos6-linux-gnu-ranlib

Languages:

                          C: yes
                 C Compiler: /home/conda/feedstock_root/build_artifacts/hdf5_split_1571745596770/_build_env/bin/x86_64-conda_cos6-linux-gnu-cc
                   CPPFLAGS: -DNDEBUG -D_FORTIFY_SOURCE=2 -O2 -I/forebrain_organoids/fastq/zUMIs/zUMIs-env/include
                H5_CPPFLAGS: -D_GNU_SOURCE -D_POSIX_C_SOURCE=200809L   -DNDEBUG -UH5_DEBUG_API
                AM_CPPFLAGS:  -I/forebrain_organoids/fastq/zUMIs/zUMIs-env/include
                    C Flags: -march=nocona -mtune=haswell -ftree-vectorize -fPIC -fstack-protector-strong -fno-plt -O2 -ffunction-sections -pipe -I/forebrain_organoids/fastq/zUMIs/zUMIs-env/include -fdebug-prefix-map=/home/conda/feedstock_root/build_artifacts/hdf5_split_1571745596770/work=/usr/local/src/conda/hdf5_split-1.10.5 -fdebug-prefix-map=/forebrain_organoids/fastq/zUMIs/zUMIs-env=/usr/local/src/conda-prefix
                 H5 C Flags:  -std=c99  -pedantic -Wall -Wextra -Wbad-function-cast -Wc++-compat -Wcast-align -Wcast-qual -Wconversion -Wdeclaration-after-statement -Wdisabled-optimization -Wfloat-equal -Wformat=2 -Winit-self -Winvalid-pch -Wmissing-declarations -Wmissing-include-dirs -Wmissing-prototypes -Wnested-externs -Wold-style-definition -Wpacked -Wpointer-arith -Wredundant-decls -Wshadow -Wstrict-prototypes -Wswitch-default -Wswitch-enum -Wundef -Wunused-macros -Wunsafe-loop-optimizations -Wwrite-strings -finline-functions -s -Wno-inline -Wno-aggregate-return -Wno-missing-format-attribute -Wno-missing-noreturn -O
                 AM C Flags: 
           Shared C Library: yes
           Static C Library: yes

                    Fortran: yes
           Fortran Compiler: /home/conda/feedstock_root/build_artifacts/hdf5_split_1571745596770/_build_env/bin/x86_64-conda_cos6-linux-gnu-gfortran
              Fortran Flags: 
           H5 Fortran Flags:  -pedantic -Wall -Wextra -Wunderflow -Wimplicit-interface -Wsurprising -Wno-c-binding-type  -s -O2
           AM Fortran Flags: 
     Shared Fortran Library: yes
     Static Fortran Library: yes

                        C++: yes
               C++ Compiler: /home/conda/feedstock_root/build_artifacts/hdf5_split_1571745596770/_build_env/bin/x86_64-conda_cos6-linux-gnu-c++
                  C++ Flags: -fvisibility-inlines-hidden -std=c++17 -fmessage-length=0 -march=nocona -mtune=haswell -ftree-vectorize -fPIC -fstack-protector-strong -fno-plt -O2 -ffunction-sections -pipe -I/forebrain_organoids/fastq/zUMIs/zUMIs-env/include -fdebug-prefix-map=/home/conda/feedstock_root/build_artifacts/hdf5_split_1571745596770/work=/usr/local/src/conda/hdf5_split-1.10.5 -fdebug-prefix-map=/forebrain_organoids/fastq/zUMIs/zUMIs-env=/usr/local/src/conda-prefix
               H5 C++ Flags:   -pedantic -Wall -W -Wundef -Wshadow -Wpointer-arith -Wcast-qual -Wcast-align -Wwrite-strings -Wconversion -Wredundant-decls -Winline -Wsign-promo -Woverloaded-virtual -Wold-style-cast -Weffc++ -Wreorder -Wnon-virtual-dtor -Wctor-dtor-privacy -Wabi -finline-functions -s -O
               AM C++ Flags: 
         Shared C++ Library: yes
         Static C++ Library: yes

                       Java: no

Features:

               Parallel HDF5: no

Parallel Filtered Dataset Writes: no Large Parallel I/O: no High-level library: yes Threadsafety: yes Default API mapping: v110 With deprecated public symbols: yes I/O filters (external): deflate(zlib) MPE: no Direct VFD: no dmalloc: no Packages w/ extra debug output: none API tracing: no Using memory checker: yes Memory allocation sanity checks: no Function stack tracing: no Strict file format checks: no Optimization instrumentation: no Bye... /forebrain_organoids/fastq/zUMIs/zUMIs.sh: line 307: 89210 Aborted ${Rexc} ${zumisdir}/misc/rds2loom.R ${yaml} Wed Dec 8 19:05:01 EST 2021 [1] "2021-12-08 19:05:02 EST" [1] "Preparing bam file for velocyto..." [1] "2021-12-08 19:13:03 EST" [1] "Attempting to run RNA velocity..." [1] "RNA velocity done!" [1] "2021-12-08 19:27:07 EST" Descriptive statistics... [1] "I am loading useful packages for plotting..." [1] "2021-12-08 19:27:07 EST" Registered S3 methods overwritten by 'ggplot2': method from [.quosures rlang c.quosures rlang print.quosures rlang summarise() ungrouping output (override with .groups argument) [1] "4.5e+08 Reads per chunk" [1] "Extracting reads from bam file(s)..." [1] "Working on chunk 1" summarise() ungrouping output (override with .groups argument) used (Mb) gc trigger (Mb) max used (Mb) Ncells 4296965 229.5 8125194 434.0 8125194 434.0 Vcells 39541253 301.7 218179210 1664.6 272441934 2078.6`

and here is my velocity log:

`2021-12-08 19:13:32,927 - DEBUG - Using logic: Default 2021-12-08 19:13:32,928 - INFO - Read 50 cell barcodes from /forebrain_organoids/fastq/zUMIs_output/Smartseq2_organoid.BCwhitelist.txt 2021-12-08 19:13:32,928 - DEBUG - Example of barcode: MXLZZMLS and cell_id: Smartseq2_organoid:MXLZZMLS 2021-12-08 19:13:32,928 - WARNING - --umi-extension was specified but incompatible with --without-umi, it will be ignored! 2021-12-08 19:13:32,947 - DEBUG - Peeking into /forebrain_organoids/fastq/Smartseq2_organoid.tagged.forVelocyto.bam 2021-12-08 19:13:32,952 - WARNING - The file /forebrain_organoids/fastq/cellsorted_Smartseq2_organoid.tagged.forVelocyto.bam already exists. The sorting step will be skipped and the existing file will be used. 2021-12-08 19:13:32,952 - INFO - Load the annotation from /forebrain_organoids/fastq/Smartseq2_organoid.final_annot.gtf 2021-12-08 19:13:47,057 - DEBUG - Parsing Chromosome 1 strand - [line 0] 2021-12-08 19:13:48,369 - DEBUG - Done with 1- [line 124205] 2021-12-08 19:13:48,370 - DEBUG - Assigning indexes to genes 2021-12-08 19:13:48,400 - DEBUG - Seen 2702 genes until now 2021-12-08 19:13:48,400 - DEBUG - Parsing Chromosome 1 strand + [line 124206] 2021-12-08 19:13:50,111 - DEBUG - Done with 1+ [line 265744] 2021-12-08 19:13:50,111 - DEBUG - Assigning indexes to genes 2021-12-08 19:13:50,142 - DEBUG - Seen 5477 genes until now 2021-12-08 19:13:50,142 - DEBUG - Parsing Chromosome 10 strand - [line 265745] 2021-12-08 19:13:50,500 - DEBUG - Done with 10- [line 318465] 2021-12-08 19:13:50,500 - DEBUG - Assigning indexes to genes 2021-12-08 19:13:50,511 - DEBUG - Seen 6607 genes until now 2021-12-08 19:13:50,511 - DEBUG - Parsing Chromosome 10 strand + [line 318466] 2021-12-08 19:13:51,233 - DEBUG - Done with 10+ [line 373855] 2021-12-08 19:13:51,233 - DEBUG - Assigning indexes to genes 2021-12-08 19:13:51,245 - DEBUG - Seen 7812 genes until now 2021-12-08 19:13:51,246 - DEBUG - Parsing Chromosome 11 strand - [line 373856] 2021-12-08 19:13:51,807 - DEBUG - Done with 11- [line 459084] 2021-12-08 19:13:51,807 - DEBUG - Assigning indexes to genes 2021-12-08 19:13:51,826 - DEBUG - Seen 9475 genes until now 2021-12-08 19:13:51,826 - DEBUG - Parsing Chromosome 11 strand + [line 459085] 2021-12-08 19:13:52,883 - DEBUG - Done with 11+ [line 546028] 2021-12-08 19:13:52,883 - DEBUG - Assigning indexes to genes 2021-12-08 19:13:52,905 - DEBUG - Seen 11175 genes until now 2021-12-08 19:13:52,905 - DEBUG - Parsing Chromosome 12 strand - [line 546029] 2021-12-08 19:13:53,602 - DEBUG - Done with 12- [line 629570] 2021-12-08 19:13:53,602 - DEBUG - Assigning indexes to genes 2021-12-08 19:13:53,622 - DEBUG - Seen 12687 genes until now 2021-12-08 19:13:53,622 - DEBUG - Parsing Chromosome 12 strand + [line 629571] 2021-12-08 19:13:54,829 - DEBUG - Done with 12+ [line 712606] 2021-12-08 19:13:54,829 - DEBUG - Assigning indexes to genes 2021-12-08 19:13:54,851 - DEBUG - Seen 14230 genes until now 2021-12-08 19:13:54,851 - DEBUG - Parsing Chromosome 13 strand - [line 712607] 2021-12-08 19:13:55,078 - DEBUG - Done with 13- [line 734707] 2021-12-08 19:13:55,078 - DEBUG - Assigning indexes to genes 2021-12-08 19:13:55,085 - DEBUG - Seen 14938 genes until now 2021-12-08 19:13:55,085 - DEBUG - Parsing Chromosome 13 strand + [line 734708] 2021-12-08 19:13:55,339 - DEBUG - Done with 13+ [line 760037] 2021-12-08 19:13:55,339 - DEBUG - Assigning indexes to genes 2021-12-08 19:13:55,346 - DEBUG - Seen 15630 genes until now 2021-12-08 19:13:55,346 - DEBUG - Parsing Chromosome 14 strand - [line 760038] 2021-12-08 19:13:55,750 - DEBUG - Done with 14- [line 806596] 2021-12-08 19:13:55,750 - DEBUG - Assigning indexes to genes 2021-12-08 19:13:55,761 - DEBUG - Seen 16740 genes until now 2021-12-08 19:13:55,761 - DEBUG - Parsing Chromosome 14 strand + [line 806597] 2021-12-08 19:13:56,728 - DEBUG - Done with 14+ [line 860994] 2021-12-08 19:13:56,728 - DEBUG - Assigning indexes to genes 2021-12-08 19:13:56,744 - DEBUG - Seen 17917 genes until now 2021-12-08 19:13:56,745 - DEBUG - Parsing Chromosome 15 strand - [line 860995] 2021-12-08 19:13:57,141 - DEBUG - Done with 15- [line 915299] 2021-12-08 19:13:57,141 - DEBUG - Assigning indexes to genes 2021-12-08 19:13:57,154 - DEBUG - Seen 19010 genes until now 2021-12-08 19:13:57,155 - DEBUG - Parsing Chromosome 15 strand + [line 915300] 2021-12-08 19:13:57,540 - DEBUG - Done with 15+ [line 969439] 2021-12-08 19:13:57,540 - DEBUG - Assigning indexes to genes 2021-12-08 19:13:57,554 - DEBUG - Seen 20134 genes until now 2021-12-08 19:13:57,554 - DEBUG - Parsing Chromosome 16 strand - [line 969440] 2021-12-08 19:13:57,955 - DEBUG - Done with 16- [line 1028958] 2021-12-08 19:13:57,955 - DEBUG - Assigning indexes to genes 2021-12-08 19:13:57,969 - DEBUG - Seen 21375 genes until now 2021-12-08 19:13:57,970 - DEBUG - Parsing Chromosome 16 strand + [line 1028959] 2021-12-08 19:13:58,477 - DEBUG - Done with 16+ [line 1104961] 2021-12-08 19:13:58,478 - DEBUG - Assigning indexes to genes 2021-12-08 19:13:58,497 - DEBUG - Seen 22691 genes until now 2021-12-08 19:13:58,498 - DEBUG - Parsing Chromosome 17 strand - [line 1104962] 2021-12-08 19:13:59,638 - DEBUG - Done with 17- [line 1196157] 2021-12-08 19:13:59,638 - DEBUG - Assigning indexes to genes 2021-12-08 19:13:59,657 - DEBUG - Seen 24248 genes until now 2021-12-08 19:13:59,658 - DEBUG - Parsing Chromosome 17 strand + [line 1196158] 2021-12-08 19:14:00,193 - DEBUG - Done with 17+ [line 1278860] 2021-12-08 19:14:00,193 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:00,211 - DEBUG - Seen 25750 genes until now 2021-12-08 19:14:00,211 - DEBUG - Parsing Chromosome 18 strand - [line 1278861] 2021-12-08 19:14:00,397 - DEBUG - Done with 18- [line 1306446] 2021-12-08 19:14:00,397 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:00,404 - DEBUG - Seen 26357 genes until now 2021-12-08 19:14:00,404 - DEBUG - Parsing Chromosome 18 strand + [line 1306447] 2021-12-08 19:14:00,612 - DEBUG - Done with 18+ [line 1331104] 2021-12-08 19:14:00,612 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:00,619 - DEBUG - Seen 26994 genes until now 2021-12-08 19:14:00,619 - DEBUG - Parsing Chromosome 19 strand - [line 1331105] 2021-12-08 19:14:01,343 - DEBUG - Done with 19- [line 1415327] 2021-12-08 19:14:01,343 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:01,362 - DEBUG - Seen 28453 genes until now 2021-12-08 19:14:01,362 - DEBUG - Parsing Chromosome 19 strand + [line 1415328] 2021-12-08 19:14:02,943 - DEBUG - Done with 19+ [line 1504018] 2021-12-08 19:14:02,943 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:02,963 - DEBUG - Seen 29985 genes until now 2021-12-08 19:14:02,964 - DEBUG - Parsing Chromosome 2 strand - [line 1504019] 2021-12-08 19:14:03,726 - DEBUG - Done with 2- [line 1616214] 2021-12-08 19:14:03,726 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:03,749 - DEBUG - Seen 32056 genes until now 2021-12-08 19:14:03,749 - DEBUG - Parsing Chromosome 2 strand + [line 1616215] 2021-12-08 19:14:04,455 - DEBUG - Done with 2+ [line 1720514] 2021-12-08 19:14:04,455 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:04,480 - DEBUG - Seen 34185 genes until now 2021-12-08 19:14:04,480 - DEBUG - Parsing Chromosome 20 strand - [line 1720515] 2021-12-08 19:14:04,694 - DEBUG - Done with 20- [line 1751641] 2021-12-08 19:14:04,694 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:04,702 - DEBUG - Seen 34921 genes until now 2021-12-08 19:14:04,702 - DEBUG - Parsing Chromosome 20 strand + [line 1751642] 2021-12-08 19:14:04,950 - DEBUG - Done with 20+ [line 1788343] 2021-12-08 19:14:04,951 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:04,959 - DEBUG - Seen 35643 genes until now 2021-12-08 19:14:04,959 - DEBUG - Parsing Chromosome 21 strand - [line 1788344] 2021-12-08 19:14:05,073 - DEBUG - Done with 21- [line 1804585] 2021-12-08 19:14:05,074 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:05,079 - DEBUG - Seen 36079 genes until now 2021-12-08 19:14:05,079 - DEBUG - Parsing Chromosome 21 strand + [line 1804586] 2021-12-08 19:14:05,203 - DEBUG - Done with 21+ [line 1821609] 2021-12-08 19:14:05,203 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:05,208 - DEBUG - Seen 36517 genes until now 2021-12-08 19:14:05,208 - DEBUG - Parsing Chromosome 22 strand - [line 1821610] 2021-12-08 19:14:05,397 - DEBUG - Done with 22- [line 1849872] 2021-12-08 19:14:05,397 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:05,404 - DEBUG - Seen 37141 genes until now 2021-12-08 19:14:05,404 - DEBUG - Parsing Chromosome 22 strand + [line 1849873] 2021-12-08 19:14:06,401 - DEBUG - Done with 22+ [line 1884113] 2021-12-08 19:14:06,401 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:06,410 - DEBUG - Seen 37905 genes until now 2021-12-08 19:14:06,410 - DEBUG - Parsing Chromosome 3 strand - [line 1884114] 2021-12-08 19:14:07,216 - DEBUG - Done with 3- [line 1977600] 2021-12-08 19:14:07,216 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:07,238 - DEBUG - Seen 39498 genes until now 2021-12-08 19:14:07,238 - DEBUG - Parsing Chromosome 3 strand + [line 1977601] 2021-12-08 19:14:08,128 - DEBUG - Done with 3+ [line 2072270] 2021-12-08 19:14:08,128 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:08,152 - DEBUG - Seen 41095 genes until now 2021-12-08 19:14:08,152 - DEBUG - Parsing Chromosome 4 strand - [line 2072271] 2021-12-08 19:14:08,697 - DEBUG - Done with 4- [line 2131691] 2021-12-08 19:14:08,697 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:08,713 - DEBUG - Seen 42406 genes until now 2021-12-08 19:14:08,713 - DEBUG - Parsing Chromosome 4 strand + [line 2131692] 2021-12-08 19:14:09,257 - DEBUG - Done with 4+ [line 2194408] 2021-12-08 19:14:09,257 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:09,280 - DEBUG - Seen 43751 genes until now 2021-12-08 19:14:09,280 - DEBUG - Parsing Chromosome 5 strand - [line 2194409] 2021-12-08 19:14:09,738 - DEBUG - Done with 5- [line 2254993] 2021-12-08 19:14:09,738 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:09,753 - DEBUG - Seen 45244 genes until now 2021-12-08 19:14:09,753 - DEBUG - Parsing Chromosome 5 strand + [line 2254994] 2021-12-08 19:14:10,297 - DEBUG - Done with 5+ [line 2323793] 2021-12-08 19:14:10,297 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:10,315 - DEBUG - Seen 46739 genes until now 2021-12-08 19:14:10,315 - DEBUG - Parsing Chromosome 6 strand - [line 2323794] 2021-12-08 19:14:11,633 - DEBUG - Done with 6- [line 2393690] 2021-12-08 19:14:11,633 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:11,650 - DEBUG - Seen 48255 genes until now 2021-12-08 19:14:11,650 - DEBUG - Parsing Chromosome 6 strand + [line 2393691] 2021-12-08 19:14:12,072 - DEBUG - Done with 6+ [line 2457259] 2021-12-08 19:14:12,072 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:12,088 - DEBUG - Seen 49803 genes until now 2021-12-08 19:14:12,088 - DEBUG - Parsing Chromosome 7 strand - [line 2457260] 2021-12-08 19:14:12,532 - DEBUG - Done with 7- [line 2522664] 2021-12-08 19:14:12,532 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:12,547 - DEBUG - Seen 51216 genes until now 2021-12-08 19:14:12,547 - DEBUG - Parsing Chromosome 7 strand + [line 2522665] 2021-12-08 19:14:13,034 - DEBUG - Done with 7+ [line 2595661] 2021-12-08 19:14:13,035 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:13,051 - DEBUG - Seen 52818 genes until now 2021-12-08 19:14:13,051 - DEBUG - Parsing Chromosome 8 strand - [line 2595662] 2021-12-08 19:14:13,405 - DEBUG - Done with 8- [line 2649551] 2021-12-08 19:14:13,405 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:13,420 - DEBUG - Seen 54100 genes until now 2021-12-08 19:14:13,420 - DEBUG - Parsing Chromosome 8 strand + [line 2649552] 2021-12-08 19:14:13,829 - DEBUG - Done with 8+ [line 2701356] 2021-12-08 19:14:13,829 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:13,843 - DEBUG - Seen 55301 genes until now 2021-12-08 19:14:13,843 - DEBUG - Parsing Chromosome 9 strand - [line 2701357] 2021-12-08 19:14:14,272 - DEBUG - Done with 9- [line 2749715] 2021-12-08 19:14:14,272 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:14,283 - DEBUG - Seen 56465 genes until now 2021-12-08 19:14:14,283 - DEBUG - Parsing Chromosome 9 strand + [line 2749716] 2021-12-08 19:14:14,769 - DEBUG - Done with 9+ [line 2802769] 2021-12-08 19:14:14,769 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:14,782 - DEBUG - Seen 57634 genes until now 2021-12-08 19:14:14,782 - DEBUG - Parsing Chromosome GL000009.2 strand - [line 2802770] 2021-12-08 19:14:14,782 - DEBUG - Done with GL000009.2- [line 2802777] 2021-12-08 19:14:14,782 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:14,782 - DEBUG - Seen 57635 genes until now 2021-12-08 19:14:14,782 - DEBUG - Parsing Chromosome GL000194.1 strand - [line 2802778] 2021-12-08 19:14:14,782 - DEBUG - Done with GL000194.1- [line 2802803] 2021-12-08 19:14:14,782 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:14,782 - DEBUG - Seen 57637 genes until now 2021-12-08 19:14:14,783 - DEBUG - Parsing Chromosome GL000195.1 strand - [line 2802804] 2021-12-08 19:14:14,783 - DEBUG - Done with GL000195.1- [line 2802816] 2021-12-08 19:14:14,783 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:14,783 - DEBUG - Seen 57639 genes until now 2021-12-08 19:14:14,783 - DEBUG - Parsing Chromosome GL000195.1 strand + [line 2802817] 2021-12-08 19:14:14,783 - DEBUG - Done with GL000195.1+ [line 2802830] 2021-12-08 19:14:14,783 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:14,783 - DEBUG - Seen 57640 genes until now 2021-12-08 19:14:14,783 - DEBUG - Parsing Chromosome GL000205.2 strand - [line 2802831] 2021-12-08 19:14:14,783 - DEBUG - Done with GL000205.2- [line 2802847] 2021-12-08 19:14:14,783 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:14,783 - DEBUG - Seen 57642 genes until now 2021-12-08 19:14:14,783 - DEBUG - Parsing Chromosome GL000213.1 strand - [line 2802848] 2021-12-08 19:14:14,784 - DEBUG - Done with GL000213.1- [line 2802899] 2021-12-08 19:14:14,784 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:14,784 - DEBUG - Seen 57644 genes until now 2021-12-08 19:14:14,784 - DEBUG - Parsing Chromosome GL000216.2 strand - [line 2802900] 2021-12-08 19:14:14,784 - DEBUG - Done with GL000216.2- [line 2802902] 2021-12-08 19:14:14,784 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:14,784 - DEBUG - Seen 57645 genes until now 2021-12-08 19:14:14,784 - DEBUG - Parsing Chromosome GL000218.1 strand - [line 2802903] 2021-12-08 19:14:14,784 - DEBUG - Done with GL000218.1- [line 2802910] 2021-12-08 19:14:14,784 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:14,784 - DEBUG - Seen 57646 genes until now 2021-12-08 19:14:14,784 - DEBUG - Parsing Chromosome GL000219.1 strand - [line 2802911] 2021-12-08 19:14:14,784 - DEBUG - Done with GL000219.1- [line 2802922] 2021-12-08 19:14:14,784 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:14,784 - DEBUG - Seen 57647 genes until now 2021-12-08 19:14:14,785 - DEBUG - Parsing Chromosome GL000220.1 strand + [line 2802923] 2021-12-08 19:14:14,785 - DEBUG - Done with GL000220.1+ [line 2802934] 2021-12-08 19:14:14,785 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:14,785 - DEBUG - Seen 57651 genes until now 2021-12-08 19:14:14,785 - DEBUG - Parsing Chromosome GL000225.1 strand + [line 2802935] 2021-12-08 19:14:14,785 - DEBUG - Done with GL000225.1+ [line 2802937] 2021-12-08 19:14:14,785 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:14,785 - DEBUG - Seen 57652 genes until now 2021-12-08 19:14:14,785 - DEBUG - Parsing Chromosome KI270442.1 strand - [line 2802938] 2021-12-08 19:14:14,785 - DEBUG - Done with KI270442.1- [line 2802940] 2021-12-08 19:14:14,785 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:14,785 - DEBUG - Seen 57653 genes until now 2021-12-08 19:14:14,785 - DEBUG - Parsing Chromosome KI270442.1 strand + [line 2802941] 2021-12-08 19:14:14,785 - DEBUG - Done with KI270442.1+ [line 2802943] 2021-12-08 19:14:14,785 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:14,785 - DEBUG - Seen 57654 genes until now 2021-12-08 19:14:14,785 - DEBUG - Parsing Chromosome KI270711.1 strand - [line 2802944] 2021-12-08 19:14:14,786 - DEBUG - Done with KI270711.1- [line 2803094] 2021-12-08 19:14:14,786 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:14,787 - DEBUG - Seen 57655 genes until now 2021-12-08 19:14:14,787 - DEBUG - Parsing Chromosome KI270713.1 strand - [line 2803095] 2021-12-08 19:14:14,787 - DEBUG - Done with KI270713.1- [line 2803108] 2021-12-08 19:14:14,787 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:14,787 - DEBUG - Seen 57658 genes until now 2021-12-08 19:14:14,787 - DEBUG - Parsing Chromosome KI270713.1 strand + [line 2803109] 2021-12-08 19:14:14,787 - DEBUG - Done with KI270713.1+ [line 2803114] 2021-12-08 19:14:14,787 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:14,787 - DEBUG - Seen 57659 genes until now 2021-12-08 19:14:14,787 - DEBUG - Parsing Chromosome KI270721.1 strand + [line 2803115] 2021-12-08 19:14:14,787 - DEBUG - Done with KI270721.1+ [line 2803139] 2021-12-08 19:14:14,787 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:14,787 - DEBUG - Seen 57663 genes until now 2021-12-08 19:14:14,787 - DEBUG - Parsing Chromosome KI270726.1 strand + [line 2803140] 2021-12-08 19:14:14,787 - DEBUG - Done with KI270726.1+ [line 2803150] 2021-12-08 19:14:14,788 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:14,788 - DEBUG - Seen 57665 genes until now 2021-12-08 19:14:14,788 - DEBUG - Parsing Chromosome KI270727.1 strand - [line 2803151] 2021-12-08 19:14:14,788 - DEBUG - Done with KI270727.1- [line 2803216] 2021-12-08 19:14:14,788 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:14,788 - DEBUG - Seen 57669 genes until now 2021-12-08 19:14:14,788 - DEBUG - Parsing Chromosome KI270727.1 strand + [line 2803217] 2021-12-08 19:14:14,788 - DEBUG - Done with KI270727.1+ [line 2803238] 2021-12-08 19:14:14,788 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:14,788 - DEBUG - Seen 57673 genes until now 2021-12-08 19:14:14,789 - DEBUG - Parsing Chromosome KI270728.1 strand - [line 2803239] 2021-12-08 19:14:14,789 - DEBUG - Done with KI270728.1- [line 2803315] 2021-12-08 19:14:14,789 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:14,789 - DEBUG - Seen 57675 genes until now 2021-12-08 19:14:14,789 - DEBUG - Parsing Chromosome KI270728.1 strand + [line 2803316] 2021-12-08 19:14:14,790 - DEBUG - Done with KI270728.1+ [line 2803358] 2021-12-08 19:14:14,790 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:14,790 - DEBUG - Seen 57681 genes until now 2021-12-08 19:14:14,790 - DEBUG - Parsing Chromosome KI270731.1 strand - [line 2803359] 2021-12-08 19:14:14,790 - DEBUG - Done with KI270731.1- [line 2803369] 2021-12-08 19:14:14,790 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:14,790 - DEBUG - Seen 57683 genes until now 2021-12-08 19:14:14,790 - DEBUG - Parsing Chromosome KI270733.1 strand + [line 2803370] 2021-12-08 19:14:14,790 - DEBUG - Done with KI270733.1+ [line 2803381] 2021-12-08 19:14:14,790 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:14,790 - DEBUG - Seen 57687 genes until now 2021-12-08 19:14:14,790 - DEBUG - Parsing Chromosome KI270734.1 strand - [line 2803382] 2021-12-08 19:14:14,791 - DEBUG - Done with KI270734.1- [line 2803450] 2021-12-08 19:14:14,791 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:14,791 - DEBUG - Seen 57688 genes until now 2021-12-08 19:14:14,791 - DEBUG - Parsing Chromosome KI270734.1 strand + [line 2803451] 2021-12-08 19:14:14,792 - DEBUG - Done with KI270734.1+ [line 2803477] 2021-12-08 19:14:14,792 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:14,792 - DEBUG - Seen 57691 genes until now 2021-12-08 19:14:14,792 - DEBUG - Parsing Chromosome KI270744.1 strand - [line 2803478] 2021-12-08 19:14:14,792 - DEBUG - Done with KI270744.1- [line 2803480] 2021-12-08 19:14:14,792 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:14,792 - DEBUG - Seen 57692 genes until now 2021-12-08 19:14:14,792 - DEBUG - Parsing Chromosome KI270750.1 strand + [line 2803481] 2021-12-08 19:14:14,792 - DEBUG - Done with KI270750.1+ [line 2803483] 2021-12-08 19:14:14,792 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:14,792 - DEBUG - Seen 57693 genes until now 2021-12-08 19:14:14,792 - DEBUG - Parsing Chromosome MT strand - [line 2803484] 2021-12-08 19:14:14,792 - DEBUG - Done with MT- [line 2803513] 2021-12-08 19:14:14,792 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:14,792 - DEBUG - Seen 57702 genes until now 2021-12-08 19:14:14,792 - DEBUG - Parsing Chromosome MT strand + [line 2803514] 2021-12-08 19:14:14,793 - DEBUG - Done with MT+ [line 2803627] 2021-12-08 19:14:14,793 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:14,793 - DEBUG - Seen 57730 genes until now 2021-12-08 19:14:14,793 - DEBUG - Parsing Chromosome X strand - [line 2803628] 2021-12-08 19:14:15,141 - DEBUG - Done with X- [line 2850229] 2021-12-08 19:14:15,141 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:15,152 - DEBUG - Seen 58913 genes until now 2021-12-08 19:14:15,152 - DEBUG - Parsing Chromosome X strand + [line 2850230] 2021-12-08 19:14:15,524 - DEBUG - Done with X+ [line 2897157] 2021-12-08 19:14:15,524 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:15,536 - DEBUG - Seen 60154 genes until now 2021-12-08 19:14:15,536 - DEBUG - Parsing Chromosome Y strand - [line 2897158] 2021-12-08 19:14:15,568 - DEBUG - Done with Y- [line 2900958] 2021-12-08 19:14:15,568 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:15,570 - DEBUG - Seen 60416 genes until now 2021-12-08 19:14:15,570 - DEBUG - Parsing Chromosome Y strand + [line 2900959] 2021-12-08 19:14:15,599 - DEBUG - Assigning indexes to genes 2021-12-08 19:14:15,601 - DEBUG - Done with Y+ [line 2905052] 2021-12-08 19:14:15,601 - DEBUG - Fixing corner cases of transcript models containg intron longer than 1000Kbp 2021-12-08 19:14:19,232 - DEBUG - Generated 2525140 features corresponding to 227818 transcript models from /forebrain_organoids/fastq/Smartseq2_organoid.final_annot.gtf 2021-12-08 19:14:19,274 - INFO - Scan /forebrain_organoids/fastq/Smartseq2_organoid.tagged.forVelocyto.bam to validate intron intervals 2021-12-08 19:14:28,316 - DEBUG - Reading /forebrain_organoids/fastq/Smartseq2_organoid.tagged.forVelocyto.bam 2021-12-08 19:14:28,320 - DEBUG - Read first 0 million reads 2021-12-08 19:14:28,320 - DEBUG - Marking up chromosome 1 2021-12-08 19:15:30,991 - DEBUG - Marking up chromosome 10 2021-12-08 19:15:49,508 - DEBUG - Marking up chromosome 11 2021-12-08 19:16:29,793 - DEBUG - Marking up chromosome 12 2021-12-08 19:17:21,737 - DEBUG - Marking up chromosome 13 2021-12-08 19:17:32,794 - DEBUG - Marking up chromosome 14 2021-12-08 19:17:55,803 - DEBUG - Marking up chromosome 15 2021-12-08 19:18:15,910 - DEBUG - Marking up chromosome 16 2021-12-08 19:18:37,803 - DEBUG - Marking up chromosome 17 2021-12-08 19:19:18,972 - DEBUG - Marking up chromosome 18 2021-12-08 19:19:27,928 - DEBUG - Marking up chromosome 19 2021-12-08 19:20:02,922 - DEBUG - Marking up chromosome 2 2021-12-08 19:20:46,284 - DEBUG - Marking up chromosome 20 2021-12-08 19:21:02,820 - DEBUG - Marking up chromosome 21 2021-12-08 19:21:18,119 - DEBUG - Read first 10 million reads 2021-12-08 19:21:27,433 - DEBUG - Marking up chromosome 22 2021-12-08 19:21:41,659 - DEBUG - Marking up chromosome 3 2021-12-08 19:22:14,081 - DEBUG - Marking up chromosome 4 2021-12-08 19:22:34,959 - DEBUG - Marking up chromosome 5 2021-12-08 19:23:09,111 - DEBUG - Marking up chromosome 6 2021-12-08 19:23:45,411 - DEBUG - Marking up chromosome 7 2021-12-08 19:24:21,181 - DEBUG - Marking up chromosome 8 2021-12-08 19:24:42,899 - DEBUG - Marking up chromosome 9 2021-12-08 19:25:03,877 - DEBUG - Marking up chromosome MT 2021-12-08 19:25:44,460 - DEBUG - Marking up chromosome X 2021-12-08 19:26:13,340 - DEBUG - Marking up chromosome Y 2021-12-08 19:26:13,402 - DEBUG - Marking up chromosome KI270728.1 2021-12-08 19:26:13,404 - DEBUG - Marking up chromosome KI270727.1 2021-12-08 19:26:13,404 - DEBUG - Marking up chromosome KI270442.1 2021-12-08 19:26:13,405 - DEBUG - Marking up chromosome KI270729.1 2021-12-08 19:26:13,405 - WARNING - The .bam file refers to a chromosome 'KI270729.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:13,405 - WARNING - The .bam file refers to a chromosome 'KI270729.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:13,406 - DEBUG - Marking up chromosome GL000225.1 2021-12-08 19:26:13,406 - WARNING - The .bam file refers to a chromosome 'GL000225.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:13,408 - DEBUG - Marking up chromosome KI270743.1 2021-12-08 19:26:13,408 - WARNING - The .bam file refers to a chromosome 'KI270743.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:13,408 - WARNING - The .bam file refers to a chromosome 'KI270743.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:13,410 - DEBUG - Marking up chromosome GL000008.2 2021-12-08 19:26:13,410 - WARNING - The .bam file refers to a chromosome 'GL000008.2+' not present in the annotation (.gtf) file 2021-12-08 19:26:13,410 - WARNING - The .bam file refers to a chromosome 'GL000008.2-' not present in the annotation (.gtf) file 2021-12-08 19:26:13,411 - DEBUG - Marking up chromosome GL000009.2 2021-12-08 19:26:13,412 - WARNING - The .bam file refers to a chromosome 'GL000009.2+' not present in the annotation (.gtf) file 2021-12-08 19:26:13,412 - DEBUG - Marking up chromosome KI270747.1 2021-12-08 19:26:13,412 - WARNING - The .bam file refers to a chromosome 'KI270747.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:13,412 - WARNING - The .bam file refers to a chromosome 'KI270747.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:13,412 - DEBUG - Marking up chromosome KI270722.1 2021-12-08 19:26:13,412 - WARNING - The .bam file refers to a chromosome 'KI270722.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:13,412 - WARNING - The .bam file refers to a chromosome 'KI270722.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:13,412 - DEBUG - Marking up chromosome GL000194.1 2021-12-08 19:26:13,412 - WARNING - The .bam file refers to a chromosome 'GL000194.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:13,413 - DEBUG - Marking up chromosome KI270742.1 2021-12-08 19:26:13,413 - WARNING - The .bam file refers to a chromosome 'KI270742.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:13,413 - WARNING - The .bam file refers to a chromosome 'KI270742.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:13,413 - DEBUG - Marking up chromosome GL000205.2 2021-12-08 19:26:13,413 - WARNING - The .bam file refers to a chromosome 'GL000205.2+' not present in the annotation (.gtf) file 2021-12-08 19:26:13,461 - DEBUG - Marking up chromosome GL000195.1 2021-12-08 19:26:13,530 - DEBUG - Marking up chromosome KI270736.1 2021-12-08 19:26:13,530 - WARNING - The .bam file refers to a chromosome 'KI270736.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:13,530 - WARNING - The .bam file refers to a chromosome 'KI270736.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:13,531 - DEBUG - Marking up chromosome KI270733.1 2021-12-08 19:26:13,531 - WARNING - The .bam file refers to a chromosome 'KI270733.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:14,654 - DEBUG - Marking up chromosome GL000224.1 2021-12-08 19:26:14,654 - WARNING - The .bam file refers to a chromosome 'GL000224.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:14,654 - WARNING - The .bam file refers to a chromosome 'GL000224.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:14,655 - DEBUG - Marking up chromosome GL000219.1 2021-12-08 19:26:14,656 - WARNING - The .bam file refers to a chromosome 'GL000219.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:14,657 - DEBUG - Marking up chromosome KI270719.1 2021-12-08 19:26:14,657 - WARNING - The .bam file refers to a chromosome 'KI270719.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:14,658 - WARNING - The .bam file refers to a chromosome 'KI270719.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:14,659 - DEBUG - Marking up chromosome GL000216.2 2021-12-08 19:26:14,659 - WARNING - The .bam file refers to a chromosome 'GL000216.2+' not present in the annotation (.gtf) file 2021-12-08 19:26:14,659 - DEBUG - Marking up chromosome KI270712.1 2021-12-08 19:26:14,660 - WARNING - The .bam file refers to a chromosome 'KI270712.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:14,660 - WARNING - The .bam file refers to a chromosome 'KI270712.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:14,661 - DEBUG - Marking up chromosome KI270706.1 2021-12-08 19:26:14,661 - WARNING - The .bam file refers to a chromosome 'KI270706.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:14,661 - WARNING - The .bam file refers to a chromosome 'KI270706.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:14,661 - DEBUG - Marking up chromosome KI270725.1 2021-12-08 19:26:14,662 - WARNING - The .bam file refers to a chromosome 'KI270725.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:14,662 - WARNING - The .bam file refers to a chromosome 'KI270725.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:14,664 - DEBUG - Marking up chromosome KI270744.1 2021-12-08 19:26:14,664 - WARNING - The .bam file refers to a chromosome 'KI270744.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:14,665 - DEBUG - Marking up chromosome KI270734.1 2021-12-08 19:26:14,677 - DEBUG - Marking up chromosome GL000213.1 2021-12-08 19:26:14,677 - WARNING - The .bam file refers to a chromosome 'GL000213.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:14,678 - DEBUG - Marking up chromosome GL000220.1 2021-12-08 19:26:14,678 - WARNING - The .bam file refers to a chromosome 'GL000220.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:32,269 - DEBUG - Marking up chromosome KI270715.1 2021-12-08 19:26:32,270 - WARNING - The .bam file refers to a chromosome 'KI270715.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:32,270 - WARNING - The .bam file refers to a chromosome 'KI270715.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:32,270 - DEBUG - Marking up chromosome GL000218.1 2021-12-08 19:26:32,270 - WARNING - The .bam file refers to a chromosome 'GL000218.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:32,270 - DEBUG - Marking up chromosome KI270749.1 2021-12-08 19:26:32,270 - WARNING - The .bam file refers to a chromosome 'KI270749.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:32,270 - WARNING - The .bam file refers to a chromosome 'KI270749.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:32,271 - DEBUG - Marking up chromosome KI270741.1 2021-12-08 19:26:32,271 - WARNING - The .bam file refers to a chromosome 'KI270741.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:32,271 - WARNING - The .bam file refers to a chromosome 'KI270741.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:32,271 - DEBUG - Marking up chromosome GL000221.1 2021-12-08 19:26:32,271 - WARNING - The .bam file refers to a chromosome 'GL000221.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:32,271 - WARNING - The .bam file refers to a chromosome 'GL000221.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:32,271 - DEBUG - Marking up chromosome KI270731.1 2021-12-08 19:26:32,271 - WARNING - The .bam file refers to a chromosome 'KI270731.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:32,272 - DEBUG - Marking up chromosome KI270751.1 2021-12-08 19:26:32,272 - WARNING - The .bam file refers to a chromosome 'KI270751.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:32,272 - WARNING - The .bam file refers to a chromosome 'KI270751.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:32,272 - DEBUG - Marking up chromosome KI270750.1 2021-12-08 19:26:32,272 - WARNING - The .bam file refers to a chromosome 'KI270750.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:32,273 - DEBUG - Marking up chromosome KI270519.1 2021-12-08 19:26:32,273 - WARNING - The .bam file refers to a chromosome 'KI270519.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:32,273 - WARNING - The .bam file refers to a chromosome 'KI270519.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:32,273 - DEBUG - Marking up chromosome GL000214.1 2021-12-08 19:26:32,273 - WARNING - The .bam file refers to a chromosome 'GL000214.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:32,273 - WARNING - The .bam file refers to a chromosome 'GL000214.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:32,274 - DEBUG - Marking up chromosome KI270708.1 2021-12-08 19:26:32,274 - WARNING - The .bam file refers to a chromosome 'KI270708.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:32,274 - WARNING - The .bam file refers to a chromosome 'KI270708.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:32,274 - DEBUG - Marking up chromosome KI270730.1 2021-12-08 19:26:32,274 - WARNING - The .bam file refers to a chromosome 'KI270730.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:32,274 - WARNING - The .bam file refers to a chromosome 'KI270730.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:32,274 - DEBUG - Marking up chromosome KI270438.1 2021-12-08 19:26:32,274 - WARNING - The .bam file refers to a chromosome 'KI270438.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:32,274 - WARNING - The .bam file refers to a chromosome 'KI270438.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:32,276 - DEBUG - Marking up chromosome KI270737.1 2021-12-08 19:26:32,276 - WARNING - The .bam file refers to a chromosome 'KI270737.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:32,276 - WARNING - The .bam file refers to a chromosome 'KI270737.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:32,279 - DEBUG - Marking up chromosome KI270721.1 2021-12-08 19:26:32,279 - WARNING - The .bam file refers to a chromosome 'KI270721.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:32,292 - DEBUG - Marking up chromosome KI270738.1 2021-12-08 19:26:32,292 - WARNING - The .bam file refers to a chromosome 'KI270738.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:32,292 - WARNING - The .bam file refers to a chromosome 'KI270738.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:32,292 - DEBUG - Marking up chromosome KI270748.1 2021-12-08 19:26:32,292 - WARNING - The .bam file refers to a chromosome 'KI270748.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:32,292 - WARNING - The .bam file refers to a chromosome 'KI270748.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:32,293 - DEBUG - Marking up chromosome KI270435.1 2021-12-08 19:26:32,293 - WARNING - The .bam file refers to a chromosome 'KI270435.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:32,293 - WARNING - The .bam file refers to a chromosome 'KI270435.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:32,293 - DEBUG - Marking up chromosome GL000208.1 2021-12-08 19:26:32,293 - WARNING - The .bam file refers to a chromosome 'GL000208.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:32,293 - WARNING - The .bam file refers to a chromosome 'GL000208.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:32,293 - DEBUG - Marking up chromosome KI270538.1 2021-12-08 19:26:32,293 - WARNING - The .bam file refers to a chromosome 'KI270538.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:32,293 - WARNING - The .bam file refers to a chromosome 'KI270538.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:32,293 - DEBUG - Marking up chromosome KI270756.1 2021-12-08 19:26:32,293 - WARNING - The .bam file refers to a chromosome 'KI270756.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:32,293 - WARNING - The .bam file refers to a chromosome 'KI270756.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:32,293 - DEBUG - Marking up chromosome KI270739.1 2021-12-08 19:26:32,294 - WARNING - The .bam file refers to a chromosome 'KI270739.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:32,294 - WARNING - The .bam file refers to a chromosome 'KI270739.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:32,294 - DEBUG - Marking up chromosome KI270757.1 2021-12-08 19:26:32,294 - WARNING - The .bam file refers to a chromosome 'KI270757.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:32,294 - WARNING - The .bam file refers to a chromosome 'KI270757.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:32,294 - DEBUG - Marking up chromosome KI270709.1 2021-12-08 19:26:32,294 - WARNING - The .bam file refers to a chromosome 'KI270709.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:32,294 - WARNING - The .bam file refers to a chromosome 'KI270709.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:32,295 - DEBUG - Marking up chromosome KI270746.1 2021-12-08 19:26:32,295 - WARNING - The .bam file refers to a chromosome 'KI270746.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:32,295 - WARNING - The .bam file refers to a chromosome 'KI270746.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:32,296 - DEBUG - Marking up chromosome KI270753.1 2021-12-08 19:26:32,296 - WARNING - The .bam file refers to a chromosome 'KI270753.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:32,296 - WARNING - The .bam file refers to a chromosome 'KI270753.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:32,296 - DEBUG - Marking up chromosome KI270735.1 2021-12-08 19:26:32,296 - WARNING - The .bam file refers to a chromosome 'KI270735.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:32,296 - WARNING - The .bam file refers to a chromosome 'KI270735.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:32,296 - DEBUG - Marking up chromosome KI270711.1 2021-12-08 19:26:32,296 - WARNING - The .bam file refers to a chromosome 'KI270711.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:32,319 - DEBUG - Marking up chromosome KI270745.1 2021-12-08 19:26:32,319 - WARNING - The .bam file refers to a chromosome 'KI270745.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:32,319 - WARNING - The .bam file refers to a chromosome 'KI270745.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:32,322 - DEBUG - Marking up chromosome KI270714.1 2021-12-08 19:26:32,322 - WARNING - The .bam file refers to a chromosome 'KI270714.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:32,322 - WARNING - The .bam file refers to a chromosome 'KI270714.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:32,322 - DEBUG - Marking up chromosome KI270732.1 2021-12-08 19:26:32,322 - WARNING - The .bam file refers to a chromosome 'KI270732.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:32,322 - WARNING - The .bam file refers to a chromosome 'KI270732.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:32,322 - DEBUG - Marking up chromosome KI270713.1 2021-12-08 19:26:32,328 - DEBUG - Marking up chromosome KI270754.1 2021-12-08 19:26:32,328 - WARNING - The .bam file refers to a chromosome 'KI270754.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:32,328 - WARNING - The .bam file refers to a chromosome 'KI270754.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:32,329 - DEBUG - Marking up chromosome KI270710.1 2021-12-08 19:26:32,329 - WARNING - The .bam file refers to a chromosome 'KI270710.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:32,329 - WARNING - The .bam file refers to a chromosome 'KI270710.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:32,329 - DEBUG - Marking up chromosome KI270717.1 2021-12-08 19:26:32,329 - WARNING - The .bam file refers to a chromosome 'KI270717.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:32,329 - WARNING - The .bam file refers to a chromosome 'KI270717.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:32,330 - DEBUG - Marking up chromosome KI270724.1 2021-12-08 19:26:32,330 - WARNING - The .bam file refers to a chromosome 'KI270724.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:32,330 - WARNING - The .bam file refers to a chromosome 'KI270724.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:32,330 - DEBUG - Marking up chromosome KI270723.1 2021-12-08 19:26:32,330 - WARNING - The .bam file refers to a chromosome 'KI270723.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:32,330 - WARNING - The .bam file refers to a chromosome 'KI270723.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:32,330 - DEBUG - Marking up chromosome KI270718.1 2021-12-08 19:26:32,330 - WARNING - The .bam file refers to a chromosome 'KI270718.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:32,330 - WARNING - The .bam file refers to a chromosome 'KI270718.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:32,331 - DEBUG - Marking up chromosome KI270755.1 2021-12-08 19:26:32,331 - WARNING - The .bam file refers to a chromosome 'KI270755.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:32,332 - WARNING - The .bam file refers to a chromosome 'KI270755.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:32,332 - DEBUG - Marking up chromosome KI270707.1 2021-12-08 19:26:32,332 - WARNING - The .bam file refers to a chromosome 'KI270707.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:32,332 - WARNING - The .bam file refers to a chromosome 'KI270707.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:32,332 - DEBUG - Marking up chromosome KI270322.1 2021-12-08 19:26:32,332 - WARNING - The .bam file refers to a chromosome 'KI270322.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:32,332 - WARNING - The .bam file refers to a chromosome 'KI270322.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:32,332 - DEBUG - Marking up chromosome KI270448.1 2021-12-08 19:26:32,332 - WARNING - The .bam file refers to a chromosome 'KI270448.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:32,332 - WARNING - The .bam file refers to a chromosome 'KI270448.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:32,332 - DEBUG - Marking up chromosome KI270515.1 2021-12-08 19:26:32,332 - WARNING - The .bam file refers to a chromosome 'KI270515.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:32,332 - WARNING - The .bam file refers to a chromosome 'KI270515.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:32,332 - DEBUG - Marking up chromosome KI270467.1 2021-12-08 19:26:32,333 - WARNING - The .bam file refers to a chromosome 'KI270467.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:32,333 - WARNING - The .bam file refers to a chromosome 'KI270467.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:32,335 - DEBUG - Marking up chromosome KI270362.1 2021-12-08 19:26:32,335 - WARNING - The .bam file refers to a chromosome 'KI270362.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:32,335 - WARNING - The .bam file refers to a chromosome 'KI270362.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:32,335 - DEBUG - Marking up chromosome KI270333.1 2021-12-08 19:26:32,335 - WARNING - The .bam file refers to a chromosome 'KI270333.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:32,335 - WARNING - The .bam file refers to a chromosome 'KI270333.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:32,336 - DEBUG - Marking up chromosome KI270411.1 2021-12-08 19:26:32,336 - WARNING - The .bam file refers to a chromosome 'KI270411.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:32,336 - WARNING - The .bam file refers to a chromosome 'KI270411.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:32,336 - DEBUG - Marking up chromosome KI270518.1 2021-12-08 19:26:32,336 - WARNING - The .bam file refers to a chromosome 'KI270518.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:32,336 - WARNING - The .bam file refers to a chromosome 'KI270518.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:32,336 - DEBUG - Marking up chromosome KI270418.1 2021-12-08 19:26:32,336 - WARNING - The .bam file refers to a chromosome 'KI270418.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:32,336 - WARNING - The .bam file refers to a chromosome 'KI270418.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:32,336 - DEBUG - Marking up chromosome KI270330.1 2021-12-08 19:26:32,336 - WARNING - The .bam file refers to a chromosome 'KI270330.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:32,336 - WARNING - The .bam file refers to a chromosome 'KI270330.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:32,336 - DEBUG - Marking up chromosome KI270583.1 2021-12-08 19:26:32,337 - WARNING - The .bam file refers to a chromosome 'KI270583.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:32,337 - WARNING - The .bam file refers to a chromosome 'KI270583.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:32,337 - DEBUG - Marking up chromosome KI270466.1 2021-12-08 19:26:32,337 - WARNING - The .bam file refers to a chromosome 'KI270466.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:32,337 - WARNING - The .bam file refers to a chromosome 'KI270466.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:32,339 - DEBUG - Marking up chromosome KI270337.1 2021-12-08 19:26:32,339 - WARNING - The .bam file refers to a chromosome 'KI270337.1+' not present in the annotation (.gtf) file 2021-12-08 19:26:32,339 - WARNING - The .bam file refers to a chromosome 'KI270337.1-' not present in the annotation (.gtf) file 2021-12-08 19:26:34,860 - DEBUG - End of file. Reset index: start scanning from initial position. 2021-12-08 19:26:34,860 - DEBUG - 0 reads were skipped because no apropiate cell or umi barcode was found 2021-12-08 19:26:34,861 - DEBUG - Start molecule counting! 2021-12-08 19:26:43,819 - DEBUG - Features available for chromosomes : ['1-', '1+', '10-', '10+', '11-', '11+', '12-', '12+', '13-', '13+', '14-', '14+', '15-', '15+', '16-', '16+', '17-', '17+', '18-', '18+', '19-', '19+', '2-', '2+', '20-', '20+', '21-', '21+', '22-', '22+', '3-', '3+', '4-', '4+', '5-', '5+', '6-', '6+', '7-', '7+', '8-', '8+', '9-', '9+', 'GL000009.2-', 'GL000194.1-', 'GL000195.1-', 'GL000195.1+', 'GL000205.2-', 'GL000213.1-', 'GL000216.2-', 'GL000218.1-', 'GL000219.1-', 'GL000220.1+', 'GL000225.1+', 'KI270442.1-', 'KI270442.1+', 'KI270711.1-', 'KI270713.1-', 'KI270713.1+', 'KI270721.1+', 'KI270726.1+', 'KI270727.1-', 'KI270727.1+', 'KI270728.1-', 'KI270728.1+', 'KI270731.1-', 'KI270733.1+', 'KI270734.1-', 'KI270734.1+', 'KI270744.1-', 'KI270750.1+', 'MT-', 'MT+', 'X-', 'X+', 'Y-', 'Y+'] 2021-12-08 19:26:43,819 - DEBUG - Mask available for chromosomes : [] 2021-12-08 19:26:43,819 - DEBUG - Summarizing the results of intron validation. 2021-12-08 19:26:44,743 - DEBUG - Validated 159113 introns (of which unique intervals 53989) out of 1148661 total possible introns (considering each possible transcript models). 2021-12-08 19:26:44,744 - DEBUG - Reading /forebrain_organoids/fastq/cellsorted_Smartseq2_organoid.tagged.forVelocyto.bam 2021-12-08 19:26:44,875 - DEBUG - Read first 0 million reads 2021-12-08 19:26:53,417 - DEBUG - Read first 10 million reads 2021-12-08 19:27:01,465 - DEBUG - Counting for batch 1, containing 0 cells and 0 reads 2021-12-08 19:27:01,465 - DEBUG - 0 reads not considered because fully enclosed in repeat masked regions 2021-12-08 19:27:01,466 - DEBUG - 0 reads were skipped because no apropiate cell or umi barcode was found 2021-12-08 19:27:01,466 - DEBUG - Counting done! 2021-12-08 19:27:01,489 - DEBUG - Generating output file /forebrain_organoids/fastq/zUMIs_output/velocity/Smartseq2_organoid.loom 2021-12-08 19:27:01,490 - DEBUG - Collecting row attributes 2021-12-08 19:27:02,012 - DEBUG - Generating data table 2021-12-08 19:27:02,012 - DEBUG - Writing loom file Traceback (most recent call last): File "/forebrain_organoids/fastq/zUMIs/zUMIs-env/lib/python3.6/site-packages/velocyto/commands/_run.py", line 286, in _run ds = loompy.create(filename=outfile, matrix=total, row_attrs=ra, col_attrs=ca, dtype="float32") TypeError: create() got an unexpected keyword argument 'matrix'

During handling of the above exception, another exception occurred:

Traceback (most recent call last): File "/forebrain_organoids/fastq/zUMIs/zUMIs-env/bin/velocyto", line 11, in sys.exit(cli()) File "/forebrain_organoids/fastq/zUMIs/zUMIs-env/lib/python3.6/site-packages/click/core.py", line 829, in call return self.main(args, kwargs) File "/forebrain_organoids/fastq/zUMIs/zUMIs-env/lib/python3.6/site-packages/click/core.py", line 782, in main rv = self.invoke(ctx) File "/forebrain_organoids/fastq/zUMIs/zUMIs-env/lib/python3.6/site-packages/click/core.py", line 1259, in invoke return _process_result(sub_ctx.command.invoke(sub_ctx)) File "/forebrain_organoids/fastq/zUMIs/zUMIs-env/lib/python3.6/site-packages/click/core.py", line 1066, in invoke return ctx.invoke(self.callback, ctx.params) File "/forebrain_organoids/fastq/zUMIs/zUMIs-env/lib/python3.6/site-packages/click/core.py", line 610, in invoke return callback(args, **kwargs) File "/forebrain_organoids/fastq/zUMIs/zUMIs-env/lib/python3.6/site-packages/velocyto/commands/run.py", line 116, in run samtools_memory=samtools_memory, dump=dump, loom_numeric_dtype=dtype, verbose=verbose, additional_ca=additional_ca) File "/forebrain_organoids/fastq/zUMIs/zUMIs-env/lib/python3.6/site-packages/velocyto/commands/_run.py", line 297, in _run loompy.create(filename=outfile, layers=tmp_layers, row_attrs=ra, col_attrs=ca, file_attrs={"velocyto.version": vcy.version, "velocyto.logic": logic}) File "/forebrain_organoids/fastq/zUMIs/zUMIs-env/lib/python3.6/site-packages/loompy/loompy.py", line 980, in create raise ValueError("Main matrix cannot be empty") ValueError: Main matrix cannot be empty `

I really appreciate you taking time out to help me with this. Thank you so much!

brain-discourse commented 2 years ago

I also tried running zUMIs on our real sample using smartseq3 on miseq and am running into the same error where the job gets aborted at the rds2loom step. Here is an error log for that file. I noticed that it checks for the loomR package which I don't have in my R library because the zUMIs wiki installation page didn't mention it.

` The following have been reloaded with a version change: 1) python/3.8.8 => python/3.5.1

Using miniconda environment for zUMIs! note: internal executables will be used instead of those specified in the YAML file!

You provided these parameters: YAML file: run2_miseq/zUMIs_OG/zUMIs.yaml zUMIs directory: scrnaseq/zUMIs STAR executable STAR samtools executable samtools pigz executable pigz Rscript executable Rscript RAM limit: 100 zUMIs version 2.9.7

Thu Dec 9 10:18:28 EST 2021 WARNING: The STAR version used for mapping is 2.7.3a and the STAR index was created using the version 2.7.1a. This may lead to an error while mapping. If you encounter any errors at the mapping stage, please make sure to create the STAR index using STAR 2.7.3a. Filtering... Thu Dec 9 11:09:11 EST 2021 Registered S3 methods overwritten by 'ggplot2': method from [.quosures rlang c.quosures rlang print.quosures rlang [1] "Warning! None of the annotated barcodes were detected." [1] "Continuing with top 100 barcodes instead..." [1] "183694 reads were assigned to barcodes that do not correspond to intact cells." [1] "Found 405 daughter barcodes that can be binned into 74 parent barcodes." [1] "Binned barcodes correspond to 115404 reads." Mapping... [1] "2021-12-09 11:14:58 EST" Dec 09 11:15:04 ..... started STAR run Dec 09 11:15:07 ..... loading genome Dec 09 11:15:04 ..... started STAR run Dec 09 11:15:07 ..... loading genome Dec 09 11:15:04 ..... started STAR run Dec 09 11:15:07 ..... loading genome Dec 09 11:16:04 ..... processing annotations GTF Dec 09 11:16:32 ..... processing annotations GTF Dec 09 11:16:50 ..... processing annotations GTF Dec 09 11:17:13 ..... inserting junctions into the genome indices Dec 09 11:20:24 ..... inserting junctions into the genome indices Dec 09 11:22:57 ..... inserting junctions into the genome indices Dec 09 11:48:07 ..... started 1st pass mapping Dec 09 11:50:29 ..... started 1st pass mapping Dec 09 11:52:23 ..... started 1st pass mapping Dec 09 11:59:44 ..... finished 1st pass mapping Dec 09 12:00:05 ..... inserting junctions into the genome indices Dec 09 12:07:40 ..... finished 1st pass mapping Dec 09 12:07:44 ..... inserting junctions into the genome indices Dec 09 12:07:44 ..... finished 1st pass mapping Dec 09 12:07:47 ..... inserting junctions into the genome indices Dec 09 12:14:05 ..... started mapping Dec 09 12:18:46 ..... started mapping Dec 09 12:18:53 ..... started mapping Dec 09 12:34:04 ..... finished mapping Dec 09 12:34:05 ..... finished successfully Dec 09 12:37:02 ..... finished mapping Dec 09 12:37:02 ..... finished successfully Dec 09 12:37:03 ..... finished mapping Dec 09 12:37:03 ..... finished successfully rm: cannot remove ‘run2_miseq/zUMIs_OG/results/zUMIs_output/.tmpMap/tmp.Smartseq3_pilot_miseqrun.1._STARtmp/.nfs00000001362d79aa000d9016’: Device or resource busy rm: cannot remove ‘run2_miseq/zUMIs_OG/results/zUMIs_output/.tmpMap/tmp.Smartseq3_pilot_miseqrun.1._STARtmp/.nfs0000000131ec4823000d9017’: Device or resource busy Thu Dec 9 12:37:20 EST 2021 Counting... Registered S3 methods overwritten by 'ggplot2': method from [.quosures rlang c.quosures rlang print.quosures rlang [1] "2021-12-09 12:37:49 EST" [1] "1.5e+08 Reads per chunk" [1] "Loading reference annotation from:" [1] "run2_miseq/zUMIs_OG/results/Smartseq3_pilot_miseqrun.final_annot.gtf" [1] "Annotation loaded!" Warning message: as_quosure() requires an explicit environment as of rlang 0.3.0. Please supply env. This warning is displayed once per session. [1] "Assigning reads to features (ex)"

    ==========     _____ _    _ ____  _____  ______          _____  
    =====         / ____| |  | |  _ \|  __ \|  ____|   /\   |  __ \ 
      =====      | (___ | |  | | |_) | |__) | |__     /  \  | |  | |
        ====      \___ \| |  | |  _ <|  _  /|  __|   / /\ \ | |  | |
          ====    ____) | |__| | |_) | | \ \| |____ / ____ \| |__| |
    ==========   |_____/ \____/|____/|_|  \_\______/_/    \_\_____/
   Rsubread 1.32.4
//========================== featureCounts setting ===========================\ Input files : 1 BAM file P Smartseq3_pilot_miseqrun.filtered.tagged.A ...
Annotation : R data.frame
Assignment details : .featureCounts.bam
(Note that files are saved to the output directory)
Dir for temp files : .
Threads : 50
Level : meta-feature level
Paired-end : yes
Multimapping reads : counted
Multiple alignments : primary alignment only
Multi-overlapping reads : not counted
Min overlapping bases : 1
Chimeric reads : not counted
Both ends mapped : not required

\===================== http://subread.sourceforge.net/ ======================//

//================================= Running ==================================\ Load annotation file .Rsubread_UserProvidedAnnotation_pid134260 ... Features : 349261 Meta-features : 60676 Chromosomes/contigs : 47
Process BAM file Smartseq3_pilot_miseqrun.filtered.tagged.Aligned.out. ...
Paired-end reads are included.
Assign alignments (paired-end) to features...
Total alignments : 7525943
Successfully assigned alignments : 1640887 (21.8%)
Running time : 2.10 minutes

\===================== http://subread.sourceforge.net/ ======================//

[1] "Assigning reads to features (in)"

    ==========     _____ _    _ ____  _____  ______          _____  
    =====         / ____| |  | |  _ \|  __ \|  ____|   /\   |  __ \ 
      =====      | (___ | |  | | |_) | |__) | |__     /  \  | |  | |
        ====      \___ \| |  | |  _ <|  _  /|  __|   / /\ \ | |  | |
          ====    ____) | |__| | |_) | | \ \| |____ / ____ \| |__| |
    ==========   |_____/ \____/|____/|_|  \_\______/_/    \_\_____/
   Rsubread 1.32.4
//========================== featureCounts setting ===========================\ Input files : 1 BAM file P Smartseq3_pilot_miseqrun.filtered.tagged.A ...
Annotation : R data.frame
Assignment details : .featureCounts.bam
(Note that files are saved to the output directory)
Dir for temp files : .
Threads : 50
Level : meta-feature level
Paired-end : yes
Multimapping reads : counted
Multiple alignments : primary alignment only
Multi-overlapping reads : not counted
Min overlapping bases : 1
Chimeric reads : not counted
Both ends mapped : not required

\===================== http://subread.sourceforge.net/ ======================//

//================================= Running ==================================\ Load annotation file .Rsubread_UserProvidedAnnotation_pid134260 ... Features : 240693 Meta-features : 28409 Chromosomes/contigs : 34
Process BAM file Smartseq3_pilot_miseqrun.filtered.tagged.Aligned.out. ...
Paired-end reads are included.
Assign alignments (paired-end) to features...
Total alignments : 7525943
Successfully assigned alignments : 2874118 (38.2%)
Running time : 2.33 minutes

\===================== http://subread.sourceforge.net/ ======================//

[1] "2021-12-09 12:55:57 EST" [1] "Coordinate sorting intermediate bam file..." [bam_sort_core] merging from 0 files and 50 in-memory blocks... [1] "2021-12-09 12:58:09 EST" [1] "Hamming distance collapse in barcode chunk 1 out of 1" [1] "Splitting data for multicore hamming distance collapse..." [1] "Setting up multicore cluster & generating molecule mapping tables ..." [1] "Finished multi-threaded hamming distances" [1] "Correcting UMI barcode tags..." Loading molecule correction dictionary... Correcting UB tags... [1] "4.5e+08 Reads per chunk" [1] "2021-12-09 13:04:38 EST" [1] "Here are the detected subsampling options:" [1] "Automatic downsampling" [1] "Working on barcode chunk 1 out of 1" [1] "Processing 100 barcodes in this chunk..." [1] "2021-12-09 13:10:32 EST" [1] "I am done!! Look what I produced...run2_miseq/zUMIs_OG/results/zUMIs_output/" used (Mb) gc trigger (Mb) max used (Mb) Ncells 7233183 386.3 22986336 1227.7 28732920 1534.6 Vcells 52883908 403.5 170880616 1303.8 186199066 1420.6 Thu Dec 9 13:10:34 EST 2021 Loading required package: yaml Loading required package: Matrix [1] "loomR found" Warning! HDF5 library version mismatched error The HDF5 header files used to compile this application do not match the version used by the HDF5 library to which this application is linked. Data corruption or segmentation faults may occur if the application continues. This can happen when an application was compiled by one version of HDF5 but linked with a different version of static or shared HDF5 library. You should recompile the application or check your shared library related settings such as 'LD_LIBRARY_PATH'. You can, at your own risk, disable this warning by setting the environment variable 'HDF5_DISABLE_VERSION_CHECK' to a value of '1'. Setting it to 2 or higher will suppress the warning messages totally. Headers are 1.10.4, library is 1.10.5 SUMMARY OF THE HDF5 CONFIGURATION

General Information:

               HDF5 Version: 1.10.5
              Configured on: Tue Oct 22 12:02:13 UTC 2019
              Configured by: conda@16247e67ecd5
                Host system: x86_64-conda_cos6-linux-gnu
          Uname information: Linux 16247e67ecd5 4.15.0-1059-azure #64-Ubuntu SMP Fri Sep 13 17:02:44 UTC 2019 x86_64 x86_64 x86_64 GNU/Linux
                   Byte sex: little-endian
         Installation point: scrnaseq/zUMIs/zUMIs-env

Compiling Options:

                 Build Mode: production
          Debugging Symbols: no
                    Asserts: no
                  Profiling: no
         Optimization Level: high

Linking Options:

                  Libraries: static, shared

Statically Linked Executables: LDFLAGS: -Wl,-O2 -Wl,--sort-common -Wl,--as-needed -Wl,-z,relro -Wl,-z,now -Wl,--disable-new-dtags -Wl,--gc-sections -Wl,-rpath,scrnaseq/zUMIs/zUMIs-env/lib -Wl,-rpath-link,scrnaseq/zUMIs/zUMIs-env/lib -Lscrnaseq/zUMIs/zUMIs-env/lib H5_LDFLAGS: AM_LDFLAGS: -Lscrnaseq/zUMIs/zUMIs-env/lib Extra libraries: -lrt -lpthread -lz -ldl -lm Archiver: /home/conda/feedstock_root/build_artifacts/hdf5_split_1571745596770/_build_env/bin/x86_64-conda_cos6-linux-gnu-ar AR_FLAGS: cr Ranlib: /home/conda/feedstock_root/build_artifacts/hdf5_split_1571745596770/_build_env/bin/x86_64-conda_cos6-linux-gnu-ranlib

Languages:

                          C: yes
                 C Compiler: /home/conda/feedstock_root/build_artifacts/hdf5_split_1571745596770/_build_env/bin/x86_64-conda_cos6-linux-gnu-cc
                   CPPFLAGS: -DNDEBUG -D_FORTIFY_SOURCE=2 -O2 -Iscrnaseq/zUMIs/zUMIs-env/include
                H5_CPPFLAGS: -D_GNU_SOURCE -D_POSIX_C_SOURCE=200809L   -DNDEBUG -UH5_DEBUG_API
                AM_CPPFLAGS:  -Iscrnaseq/zUMIs/zUMIs-env/include
                    C Flags: -march=nocona -mtune=haswell -ftree-vectorize -fPIC -fstack-protector-strong -fno-plt -O2 -ffunction-sections -pipe -Iscrnaseq/zUMIs/zUMIs-env/include -fdebug-prefix-map=/home/conda/feedstock_root/build_artifacts/hdf5_split_1571745596770/work=/usr/local/src/conda/hdf5_split-1.10.5 -fdebug-prefix-map=scrnaseq/zUMIs/zUMIs-env=/usr/local/src/conda-prefix
                 H5 C Flags:  -std=c99  -pedantic -Wall -Wextra -Wbad-function-cast -Wc++-compat -Wcast-align -Wcast-qual -Wconversion -Wdeclaration-after-statement -Wdisabled-optimization -Wfloat-equal -Wformat=2 -Winit-self -Winvalid-pch -Wmissing-declarations -Wmissing-include-dirs -Wmissing-prototypes -Wnested-externs -Wold-style-definition -Wpacked -Wpointer-arith -Wredundant-decls -Wshadow -Wstrict-prototypes -Wswitch-default -Wswitch-enum -Wundef -Wunused-macros -Wunsafe-loop-optimizations -Wwrite-strings -finline-functions -s -Wno-inline -Wno-aggregate-return -Wno-missing-format-attribute -Wno-missing-noreturn -O
                 AM C Flags: 
           Shared C Library: yes
           Static C Library: yes

                    Fortran: yes
           Fortran Compiler: /home/conda/feedstock_root/build_artifacts/hdf5_split_1571745596770/_build_env/bin/x86_64-conda_cos6-linux-gnu-gfortran
              Fortran Flags: 
           H5 Fortran Flags:  -pedantic -Wall -Wextra -Wunderflow -Wimplicit-interface -Wsurprising -Wno-c-binding-type  -s -O2
           AM Fortran Flags: 
     Shared Fortran Library: yes
     Static Fortran Library: yes

                        C++: yes
               C++ Compiler: /home/conda/feedstock_root/build_artifacts/hdf5_split_1571745596770/_build_env/bin/x86_64-conda_cos6-linux-gnu-c++
                  C++ Flags: -fvisibility-inlines-hidden -std=c++17 -fmessage-length=0 -march=nocona -mtune=haswell -ftree-vectorize -fPIC -fstack-protector-strong -fno-plt -O2 -ffunction-sections -pipe -Iscrnaseq/zUMIs/zUMIs-env/include -fdebug-prefix-map=/home/conda/feedstock_root/build_artifacts/hdf5_split_1571745596770/work=/usr/local/src/conda/hdf5_split-1.10.5 -fdebug-prefix-map=scrnaseq/zUMIs/zUMIs-env=/usr/local/src/conda-prefix
               H5 C++ Flags:   -pedantic -Wall -W -Wundef -Wshadow -Wpointer-arith -Wcast-qual -Wcast-align -Wwrite-strings -Wconversion -Wredundant-decls -Winline -Wsign-promo -Woverloaded-virtual -Wold-style-cast -Weffc++ -Wreorder -Wnon-virtual-dtor -Wctor-dtor-privacy -Wabi -finline-functions -s -O
               AM C++ Flags: 
         Shared C++ Library: yes
         Static C++ Library: yes

                       Java: no

Features:

               Parallel HDF5: no

Parallel Filtered Dataset Writes: no Large Parallel I/O: no High-level library: yes Threadsafety: yes Default API mapping: v110 With deprecated public symbols: yes I/O filters (external): deflate(zlib) MPE: no Direct VFD: no dmalloc: no Packages w/ extra debug output: none API tracing: no Using memory checker: yes Memory allocation sanity checks: no Function stack tracing: no Strict file format checks: no Optimization instrumentation: no Bye... scrnaseq/zUMIs/zUMIs.sh: line 307: 142628 Aborted ${Rexc} ${zumisdir}/misc/rds2loom.R ${yaml} Thu Dec 9 13:10:53 EST 2021 Descriptive statistics... [1] "I am loading useful packages for plotting..." [1] "2021-12-09 13:10:54 EST" Registered S3 methods overwritten by 'ggplot2': method from [.quosures rlang c.quosures rlang print.quosures rlang [1] "Counting UMI fragments..." summarise() ungrouping output (override with .groups argument) summarise() ungrouping output (override with .groups argument) notch went outside hinges. Try setting notch=FALSE. notch went outside hinges. Try setting notch=FALSE. notch went outside hinges. Try setting notch=FALSE. [1] "4.5e+08 Reads per chunk" [1] "Extracting reads from bam file(s)..." [1] "Working on chunk 1" summarise() ungrouping output (override with .groups argument) used (Mb) gc trigger (Mb) max used (Mb) Ncells 4302856 229.8 8125278 434.0 8125278 434.0 Vcells 26075853 199.0 96190304 733.9 119716652 913.4 Thu Dec 9 13:14:00 EST 2021 `