shangyf-stu
commented
1 year ago The yaml file above is for inDrop data, and the yaml file below is for BD Rhapsody: project: dataset466 sequence_files: file1: name: /dataset466/filter_fastp/dataset466_clean_1.fastq.gz base_definition:
- BD(1-9,22-30,44-52)
- UMI(53-60) file2: name: /dataset466/filter_fastp/dataset466_clean_2.fastq.gz base_definition:
- cDNA(1-150) reference: STAR_index: /zUMIs_v2.9.7d/star_index_2.7.1a_nogtf GTF_file: /3.2.0_star_index/Homo_sapiens.GRCh38.102.gtf exon_extension: no extension_length: 0 scaffold_length_min: 0 additional_files: additional_STAR_params: out_dir: /dataset466/zUMIs num_threads: 8 mem_limit: 20 filter_cutoffs: BC_filter: num_bases: 1 phred: 20 UMI_filter: num_bases: 1 phred: 20 barcodes: barcode_num: null barcode_file: null barcode_sharing: null automatic: yes BarcodeBinning: 1 nReadsperCell: 100 demultiplex: no counting_opts: introns: yes intronProb: no downsampling: '0' strand: 0 Ham_Dist: 0 velocyto: no primaryHit: yes multi_overlap: no fraction_overlap: 0 twoPass: yes make_stats: yes which_Stage: Filtering samtools_exec: samtools Rscript_exec: Rscript STAR_exec: STAR pigz_exec: pigz
cziegenhain
Hello, I am processing data for library construction using BD Rhapsody and inDrop. Both of them contain combined barcodes. Barcode not found in *. BCstats.txt file
The barcodes in the file are null, but there are counts. I don't know what caused this error. Additionally, in the data of InDrop, there may be 1-2 mismatches in the W1 sequence (GAGTGATTGCTTTGTGACGCCTT) in the fastq file. How to set it in zUMIs?
To Reproduce Yaml file: project: dataset467 sequence_files: file1: name: /dataset467/fastq1/dataset467_1.fastq.gz base_definition:
Screenshots Error message: Error in uik(bccount$cellindex, bccount$cs/1000) : Method is not applicable for such a small vector. Please give at least a 5 numbers vector Calls: cellBC -> .cellBarcode_unknown -> .FindBCcut -> uik Execution halted Error in fread(paste0(opt$out_dir, "/zUMIs_output/", opt$project, "kept_barcodes_binned.txt")) : File '/dataset467/zUMIs/zUMIs_output/dataset467kept_barcodes_binned.txt' does not exist or is non-readable. getwd()=='/dataset467/zUMIs' Execution halted Loading required package: yaml Loading required package: Matrix Error in gzfile(file, "rb") : cannot open the connection Calls: rds_to_loom -> readRDS -> gzfile In addition: Warning message: In gzfile(file, "rb") : cannot open compressed file '/dataset467/zUMIs/zUMIs_output/expression/dataset467.dgecounts.rds', probable reason 'No such file or directory' Execution halted Error in data.table::fread(paste0(opt$out_dir, "/zUMIs_output/", opt$project, : File '/dataset467/zUMIs/zUMIs_output/dataset467kept_barcodes.txt' does not exist or is non-readable. getwd()=='/dataset467/zUMIs' Execution halted
I hope you can provide me with some help. Thank you! Best wishes, Shang