search

sdparekh / zUMIs

zUMIs: A fast and flexible pipeline to process RNA sequencing data with UMIs
GNU General Public License v3.0
268 stars 67 forks source link

Question - about the result of kept_barcodes_binned.txt.BCUMIstats.txt #381

Open Dkaaaaa opened 7 months ago

Dkaaaaa commented 7 months ago

Hi, Below is my pm1kept_barcodes_binned.txt.BCUMIstats.txt result. I wanna know how the "nNontagged" and "nUMItag" columns comes. 1

then i chose the bc "AGATTGACTCACTAGGTGACAC" , and serch it in pm1.filtered.tagged.Aligned.toTranscriptome.out.bam, and i found that UB tag is null 2 5

then I got its corresponding reads, and I found that my pattern setted on my yaml is not at the beginning of my reads, below is my reads 3

below is my yaml text pm1-1.yaml.txt

so the "nNontagged" and "nUMItag" columns result just because of the pattern not at the beginning of my reads?

cziegenhain commented 7 months ago

Hi,

So for this particular 11bp pattern "ATTGCGCAATG" which corresponds to the Smart-seq3 TSO, our pipeline is hardcoded to only take it when it is present in the start of the read! This is why you have 0 UMI reads ("tagged") detected and seeing empty UB tags.

Dkaaaaa commented 7 months ago

Thanks a lot for your reply. Have a nice day!

bioinfotec commented 5 months ago

Hi,

So for this particular 11bp pattern "ATTGCGCAATG" which corresponds to the Smart-seq3 TSO, our pipeline is hardcoded to only take it when it is present in the start of the read! This is why you have 0 UMI reads ("tagged") detected and seeing empty UB tags.

What does "hardcoded" mean? How can I solve this problem?