sebhtml / ray

Ray -- Parallel genome assemblies for parallel DNA sequencing
http://denovoassembler.sf.net
Other
65 stars 12 forks source link

Warning: the kmer CCCCTGCACCCCTGAAATCTG has a strange coverage: 1, it will be skipped for the children listing #76

Closed sebhtml closed 11 years ago

sebhtml commented 11 years ago

This occurred when the Bloom filter yielded false positives. The k-mer academy contained a k-mer with a coverage of 2 (should be 1, but it is a false positive)

Then, in the de Bruijn graph, the real coverage was 1.

Thus the error.

The academy was removed in this merge: 290544f2628ffad344246dd36e6fdee595976f50