search

shendurelab / MPRAflow

A portable, flexible, parallelized tool for complete processing of massively parallel reporter assay data
Apache License 2.0
31 stars 16 forks source link

Error when trying the basic association workflow #45

Closed SebastienNin closed 3 years ago

SebastienNin commented 3 years ago

Hi,

I'm trying to perform the basic association workflow using the tutorial from https://mpraflow.readthedocs.io/en/latest/association_example1.html

I downloaded the fastq file using the sra-toolkit command

Here is my data folder

(MPRAflow)$ ll data/
total 13558560
-rw-rw-r-- 1 sebastiennin tgml     619200 Jul  7 10:56 design.fa
-rw-rw-r-- 1 sebastiennin tgml     192857 Jul  7 10:56 GSM4237954_9MPRA_elements.fa.gz
-rw-rw-r-- 1 sebastiennin tgml 6131739252 Jul  7 20:10 SRR10800986_1.fastq.gz
-rw-rw-r-- 1 sebastiennin tgml 1403565859 Jul  7 20:10 SRR10800986_2.fastq.gz
-rw-rw-r-- 1 sebastiennin tgml 6347816751 Jul  7 20:10 SRR10800986_3.fastq.gz

I got errors when I run the following commands:

cd path/to/MPRAflow
nextflow run association.nf -w /path/to/folder/MPRAflow_tests/Assoc_Basic/work --fastq-insert "/path/to/folder/MPRAflow_tests/Assoc_Basic/data/SRR10800986_1.fastq.gz" --fastq-insertPE "/path/to/folder/MPRAflow_tests/Assoc_Basic/data/SRR10800986_3.fastq.gz" --fastq-bc "/path/to/folder/MPRAflow_tests/Assoc_Basic/data/SRR10800986_2.fastq.gz" --design "/path/to/folder/MPRAflow_tests/Assoc_Basic/data/design.fa" --name assoc_basic

Here is the terminal output

N E X T F L O W  ~  version 20.01.0
Launching `association.nf` [elated_engelbart] - revision: 5c7544fcfa
=======================================================                                                                                                                                                     
                                          ,--./,-.
          ___     __   __   __   ___     /,-._.--~' 
    |\ | |__  __ /  ` /  \ |__) |__         }  {
    | \| |       \__, \__/ |  \ |___     \`-._,-`-, 
                                          `._,._,'                                                                                                                                                          

MPRAflow v2.3"                                                                                                                                                                                              
=======================================================
Pipeline Name  : MPRAflow                                                                             
Pipeline Version: 2.3
Fastq insert   : /path/to/folder/MPRAflow_tests/Assoc_Basic/data/SRR10800986_1.fastq.gz
fastq paired   : /path/to/folder/MPRAflow_tests/Assoc_Basic/data/SRR10800986_3.fastq.gz
Fastq barcode  : /path/to/folder/MPRAflow_tests/Assoc_Basic/data/SRR10800986_2.fastq.gz
design fasta   : /path/to/folder/MPRAflow_tests/Assoc_Basic/data/design.fa
minimum BC cov : 3                                                                                    
map quality    : 30                                                                                                                                                                                         
base quality   : 30                                                                                                                                                                                         
cigar string   : n                                                                                                                                                                                          
min % mapped   : 0.5                                                                                                                                                                                        
Output dir     : outs                                                                                                                                                                                       
Run name       : assoc_basic                                                                                                                                                                                
Working dir    : /path/to/folder/MPRAflow_tests/Assoc_Basic/work                                                                                                                          
Container Engine: null                                                                                                                                                                                      
Current home   : /cobelix/sebastiennin        
Current user   : sebastiennin                                                                                                                                                                               
Current path   :  /path/to/MPRAflow/MPRAflow                                                              
base directory : /path/to/MPRAflow/MPRAflow                                                                                                                                                                    
Script dir     : /path/to/MPRAflow/MPRAflow                                                                                                                                                                    
Config Profile : standard                                                                                                                                                                                   
=========================================          
executor >  pbs (33)                                                                                                                                                                                        
[3e/3256d2] process > count_bc_nolab       [100%] 1 of 1 ✔                                                                                                                                                  
[9e/ddc5d2] process > create_BWA_ref       [  0%] 0 of 1                                                                                                                                                    [a4/414cab] process > PE_merge             [  0%] 0 of 31                                                                                                                                                   
executor >  pbs (33)                                                                                                                                                                                        [3e/3256d2] process > count_bc_nolab       [100%] 1 of 1 ✔                                                                                                                                                  [9e/ddc5d2] process > create_BWA_ref       [100%] 1 of 1, failed: 1 ✘
[a4/414cab] process > PE_merge             [  0%] 0 of 31                                                                                                                                                   executor >  pbs (33)                                
[3e/3256d2] process > count_bc_nolab       [100%] 1 of 1 ✔                                                                                                                                                  
[9e/ddc5d2] process > create_BWA_ref       [100%] 1 of 1, failed: 1 ✘
[a4/414cab] process > PE_merge             [  0%] 0 of 1                                               
executor >  pbs (33)                                
[3e/3256d2] process > count_bc_nolab       [100%] 1 of 1 ✔                                           
[9e/ddc5d2] process > create_BWA_ref       [100%] 1 of 1, failed: 1 ✘
[-        ] process > PE_merge             -                                                                                   
executor >  pbs (33)                                                                                                                                                                                        [3e/3256d2] process > count_bc_nolab       [100%] 1 of 1 ✔                                                                                                                                                  [9e/ddc5d2] process > create_BWA_ref       [100%] 1 of 1, failed: 1 ✘                                                                                                                                       
[-        ] process > PE_merge             -                                                                                                                                                                
[-        ] process > align_BWA_PE         -                                                           
[-        ] process > collect_chunks       -        
[-        ] process > map_element_barcodes -
[-        ] process > filter_barcodes      -
WARN: Killing pending tasks (30)                                 

Error executing process > 'create_BWA_ref (make ref)'

Caused by:
  Missing output file(s) `design_rmIllegalChars.fa.fai` expected by process `create_BWA_ref (make ref)`

Command executed:                                   

  #!/bin/bash
  bwa index -a bwtsw design_rmIllegalChars.fa                                                          
  samtools faidx design_rmIllegalChars.fa
  picard CreateSequenceDictionary REFERENCE=design_rmIllegalChars.fa OUTPUT=design_rmIllegalChars.fa".dict"

Command exit status:                                
  0

Command output:                                                                                        
  (empty)                                           

Command error:                                      
  [bwa_index] Pack FASTA... 0.00 sec                                                                   
  [bwa_index] Construct BWT for the packed sequence...                                                 
  .command.sh: line 2: 27236 Floating point exception(core dumped) bwa index -a bwtsw design_rmIllegalChars.fa
  [faidx] Could not build fai index design_rmIllegalChars.fa.fai                                       
  INFO**2021-07-09 09:36:46matioCreateSequenceDictionary                                               

  ********** NOTE: Picard's command line syntax is changing.                                           
  **********                                                                                           
  ********** For more information, please see:
  ********** https://github.com/broadinstitute/picard/wiki/Command-Line-Syntax-Transition-For-Users-(Pre-Transition)
  **********                                        
  ********** The command line looks like this in the new syntax:                                       
  **********                                                                                           
  **********    CreateSequenceDictionary -REFERENCE design_rmIllegalChars.fa -OUTPUT design_rmIllegalChars.fa.dict
  **********                                                                                           

  09:36:48.874 INFO  NativeLibraryLoader - Loading libgkl_compression.so from jar:file:/path/to/folder/MPRAflow_tests/Assoc_Basic/work/conda/mpraflow_py36-1978c54da7aacd41df3c7a4cb763979
5/share/picard-2.20.8-0/picard.jar!/com/intel/gkl/native/libgkl_compression.so                         
  [Fri Jul 09 09:36:48 CEST 2021] CreateSequenceDictionary OUTPUT=design_rmIllegalChars.fa.dict REFERENCE=design_rmIllegalChars.fa    TRUNCATE_NAMES_AT_WHITESPACE=true NUM_SEQUENCES=2147483647 VERBOSITY=I
NFO QUIET=false VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false GA4GH_CLIENT_SECRETS=client_secrets.json USE_JDK_DEFLATER=false USE_JDK_
INFLATER=false
  [Fri Jul 09 09:36:48 CEST 2021] Executing as sebastiennin@n22 on Linux 2.6.32-504.12.2.el6.x86_64 amd64; OpenJDK 64-Bit Server VM 1.8.0_152-release-1056-b12; Deflater: Intel; Inflater: Intel; Provider G
CS is not available; Picard version: 2.20.8-SNAPSHOT
  [Fri Jul 09 09:36:48 CEST 2021] picard.sam.CreateSequenceDictionary done. Elapsed time: 0.00 minutes.
  Runtime.totalMemory()=514850816

Work dir:
  /path/to/folder/MPRAflow_tests/Assoc_Basic/work/9e/ddc5d268d37fdee356a063082b1183

Tip: you can try to figure out what's wrong by changing to the process work dir and showing the script file named `.command.sh`

My 'design_rmIllegalChars.fa' file is empty and thus BWA ref can't be build. Can you help me solving this issue? I should miss something.

Have a nice day, Sebastien

visze commented 3 years ago

Hi Sebastien

The error appears when a reference index is created for BWA. Here the core dumps. See this error line:

.command.sh: line 2: 27236 Floating point exception(core dumped) bwa index -a bwtsw design_rmIllegalChars.fa

Often this is the case when you run out of memory. Can you check how much memory you have available and have assign more?

Best,

Max

SebastienNin @.***> schrieb am Fr., 9. Juli 2021, 09:47:

Hi,

I'm trying to perform the basic association workflow using the tutorial from https://mpraflow.readthedocs.io/en/latest/association_example1.html

I downloaded the fastq file using the sra-toolkit command

Here is my data folder

(MPRAflow)$ ll data/

total 13558560

-rw-rw-r-- 1 sebastiennin tgml 619200 Jul 7 10:56 design.fa

-rw-rw-r-- 1 sebastiennin tgml 192857 Jul 7 10:56 GSM4237954_9MPRA_elements.fa.gz

-rw-rw-r-- 1 sebastiennin tgml 6131739252 Jul 7 20:10 SRR10800986_1.fastq.gz

-rw-rw-r-- 1 sebastiennin tgml 1403565859 Jul 7 20:10 SRR10800986_2.fastq.gz

-rw-rw-r-- 1 sebastiennin tgml 6347816751 Jul 7 20:10 SRR10800986_3.fastq.gz

I got errors when I run the following commands:

cd path/to/MPRAflow

nextflow run association.nf -w /path/to/folder/MPRAflow_tests/Assoc_Basic/work --fastq-insert "/path/to/folder/MPRAflow_tests/Assoc_Basic/data/SRR10800986_1.fastq.gz" --fastq-insertPE "/path/to/folder/MPRAflow_tests/Assoc_Basic/data/SRR10800986_3.fastq.gz" --fastq-bc "/path/to/folder/MPRAflow_tests/Assoc_Basic/data/SRR10800986_2.fastq.gz" --design "/path/to/folder/MPRAflow_tests/Assoc_Basic/data/design.fa" --name assoc_basic

Here is the terminal output

N E X T F L O W ~ version 20.01.0

Launching association.nf [elated_engelbart] - revision: 5c7544fcfa

=======================================================

                                      ,--./,-.

      ___     __   __   __   ___     /,-._.--~'

|\ | |__  __ /  ` /  \ |__) |__         }  {

| \| |       \__, \__/ |  \ |___     \`-._,-`-,

                                      `._,._,'

MPRAflow v2.3"

=======================================================

Pipeline Name : MPRAflow

Pipeline Version: 2.3

Fastq insert : /path/to/folder/MPRAflow_tests/Assoc_Basic/data/SRR10800986_1.fastq.gz

fastq paired : /path/to/folder/MPRAflow_tests/Assoc_Basic/data/SRR10800986_3.fastq.gz

Fastq barcode : /path/to/folder/MPRAflow_tests/Assoc_Basic/data/SRR10800986_2.fastq.gz

design fasta : /path/to/folder/MPRAflow_tests/Assoc_Basic/data/design.fa

minimum BC cov : 3

map quality : 30

base quality : 30

cigar string : n

min % mapped : 0.5

Output dir : outs

Run name : assoc_basic

Working dir : /path/to/folder/MPRAflow_tests/Assoc_Basic/work

Container Engine: null

Current home : /cobelix/sebastiennin

Current user : sebastiennin

Current path : /path/to/MPRAflow/MPRAflow

base directory : /path/to/MPRAflow/MPRAflow

Script dir : /path/to/MPRAflow/MPRAflow

Config Profile : standard

=========================================

executor > pbs (33)

[3e/3256d2] process > count_bc_nolab [100%] 1 of 1 ✔

[9e/ddc5d2] process > create_BWA_ref [ 0%] 0 of 1 [a4/414cab] process > PE_merge [ 0%] 0 of 31

executor > pbs (33) [3e/3256d2] process > count_bc_nolab [100%] 1 of 1 ✔ [9e/ddc5d2] process > create_BWA_ref [100%] 1 of 1, failed: 1 ✘

[a4/414cab] process > PE_merge [ 0%] 0 of 31 executor > pbs (33)

[3e/3256d2] process > count_bc_nolab [100%] 1 of 1 ✔

[9e/ddc5d2] process > create_BWA_ref [100%] 1 of 1, failed: 1 ✘

[a4/414cab] process > PE_merge [ 0%] 0 of 1

executor > pbs (33)

[3e/3256d2] process > count_bc_nolab [100%] 1 of 1 ✔

[9e/ddc5d2] process > create_BWA_ref [100%] 1 of 1, failed: 1 ✘

[- ] process > PE_merge -

executor > pbs (33) [3e/3256d2] process > count_bc_nolab [100%] 1 of 1 ✔ [9e/ddc5d2] process > create_BWA_ref [100%] 1 of 1, failed: 1 ✘

[- ] process > PE_merge -

[- ] process > align_BWA_PE -

[- ] process > collect_chunks -

[- ] process > map_element_barcodes -

[- ] process > filter_barcodes -

WARN: Killing pending tasks (30)

Error executing process > 'create_BWA_ref (make ref)'

Caused by:

Missing output file(s) design_rmIllegalChars.fa.fai expected by process create_BWA_ref (make ref)

Command executed:

!/bin/bash

bwa index -a bwtsw design_rmIllegalChars.fa

samtools faidx design_rmIllegalChars.fa

picard CreateSequenceDictionary REFERENCE=design_rmIllegalChars.fa OUTPUT=design_rmIllegalChars.fa".dict"

Command exit status:

0

Command output:

(empty)

Command error:

[bwa_index] Pack FASTA... 0.00 sec

[bwa_index] Construct BWT for the packed sequence...

.command.sh: line 2: 27236 Floating point exception(core dumped) bwa index -a bwtsw design_rmIllegalChars.fa

[faidx] Could not build fai index design_rmIllegalChars.fa.fai

INFO**2021-07-09 09:36:46matioCreateSequenceDictionary

** NOTE: Picard's command line syntax is changing.

** For more information, please see:

** https://github.com/broadinstitute/picard/wiki/Command-Line-Syntax-Transition-For-Users-(Pre-Transition)

** The command line looks like this in the new syntax:

** CreateSequenceDictionary -REFERENCE design_rmIllegalChars.fa -OUTPUT design_rmIllegalChars.fa.dict

09:36:48.874 INFO NativeLibraryLoader - Loading libgkl_compression.so from jar:file:/path/to/folder/MPRAflow_tests/Assoc_Basic/work/conda/mpraflow_py36-1978c54da7aacd41df3c7a4cb763979

5/share/picard-2.20.8-0/picard.jar!/com/intel/gkl/native/libgkl_compression.so

[Fri Jul 09 09:36:48 CEST 2021] CreateSequenceDictionary OUTPUT=design_rmIllegalChars.fa.dict REFERENCE=design_rmIllegalChars.fa TRUNCATE_NAMES_AT_WHITESPACE=true NUM_SEQUENCES=2147483647 VERBOSITY=I

NFO QUIET=false VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false GA4GH_CLIENT_SECRETS=client_secrets.json USE_JDK_DEFLATER=false USEJDK

INFLATER=false

[Fri Jul 09 09:36:48 CEST 2021] Executing as @.*** on Linux 2.6.32-504.12.2.el6.x86_64 amd64; OpenJDK 64-Bit Server VM 1.8.0_152-release-1056-b12; Deflater: Intel; Inflater: Intel; Provider G

CS is not available; Picard version: 2.20.8-SNAPSHOT

[Fri Jul 09 09:36:48 CEST 2021] picard.sam.CreateSequenceDictionary done. Elapsed time: 0.00 minutes.

Runtime.totalMemory()=514850816

Work dir:

/path/to/folder/MPRAflow_tests/Assoc_Basic/work/9e/ddc5d268d37fdee356a063082b1183

Tip: you can try to figure out what's wrong by changing to the process work dir and showing the script file named .command.sh

My 'design_rmIllegalChars.fa' file is empty and thus BWA ref can't be build. Can you help me solving this issue? I should miss something.

Have a nice day, Sebastien

— You are receiving this because you are subscribed to this thread. Reply to this email directly, view it on GitHub https://github.com/shendurelab/MPRAflow/issues/45, or unsubscribe https://github.com/notifications/unsubscribe-auth/ACGWPMEIHLZ3G3JU5OUTSBDTW2SQHANCNFSM5ACHTRCA .

SebastienNin commented 3 years ago

Here is my cluster config. Do you see something wrong with it? My HPC is running with Torque scheduler.

process { withLabel: longtime { executor='pbs' queue='lifescope' memory='80GB' clusterOptions = '-V -S /bin/bash -l nodes=1:ppn=1,walltime=72:00:00' } withLabel: shorttime { executor='pbs' queue='lifescope' memory='80GB' clusterOptions = '-V -S /bin/bash -l nodes=1:ppn=1,walltime=01:00:00' } withLabel: highmem { executor='pbs' queue='lifescope' memory='80GB' clusterOptions = '-V -S /bin/bash -l nodes=1:ppn=1,walltime=20:00:00' } }

SebastienNin commented 3 years ago

Hi Max,

Here is the results of a "ls -l" command on the working folder for MPRAflow

-rw-rw-r-- 1 sebastiennin user      6 Jul 12 15:57 count_fastq.txt
-rw-rw-r-- 1 sebastiennin user      0 Jul 12 15:57 design_rmIllegalChars.fa
-rw-rw-r-- 1 sebastiennin user 459833 Jul 12 15:57 label_rmIllegalChars.txt
-rw-rw-r-- 1 sebastiennin user 459833 Jul 12 15:57 labels.txt
lrwxrwxrwx 1 sebastiennin user     62 Jul 12 15:57 SNP_MPRA_design.fa -> path_to_analysis_folder/SNP_MPRA_design.fa
-rw-rw-r-- 1 sebastiennin user 459833 Jul 12 15:57 t_new_label.txt

As you can see, the design_rmIllegalChars.fa file is empty. Thus BWA can't index it. Did you already see this behavior before?

Have a nice day, Regards,

Sébastien

visze commented 3 years ago

Hi Sebastien,

Sorry for my late response. The memory is definitely fine. Yes you are right. The error seems to be the empty reference file. Can you send me your reference file that you used? So I can check on my site what happened.

You find my mail on this website: https://kircherlab.bihealth.org/

Best, Max

SebastienNin commented 3 years ago

Hi Max, I'm following the tutorial provided on this page

If I understand right, the reference is build using the design.fa containing CRS sequences, am I right?

If yes, I did the following:

mkdir -p Assoc_Basic/data
cd Assoc_Basic/data
wget ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM4237nnn/GSM4237954/suppl/GSM4237954_9MPRA_elements.fa.gz

zcat GSM4237954_9MPRA_elements.fa.gz |awk '{ count+=1; if (count == 1) { print } else { print substr($1,1,171)}; if (count == 2) { count=0 } }' > design.fa

Regards, Sébastien

visze commented 3 years ago

Hi Sebastien,

yes you are right. I could't reproduce the error. Is your initial design.fa file that you downloaded with the previous command from the tutorial empty? Because reported the same issue there must be something. I will try to find it. Maybe you can try to use the v2.2 release and see if you have the same issue. Because when I remember correcty I canged something here.

Best, Max

xunchen85 commented 3 years ago

Hi Max,

Yes, I got the same error as Sebastien posted.

This is the design.fa file I got using the example command line, and the same for me, the design_rmIllegalChars.fa is empty.

############ design.fa image

SebastienNin commented 3 years ago

Hi Max, my design.fa file is not empty, as mentionned by xunchen85.

the head of my file is 

head MPRAflow_tests/Assoc_Basic/data/design.fa 
>R:FOXA1-ChMod_chr7:32709843-32710013_[chr7:32709842-32710013]:012
AAGGGATAATTTAAAAGTTCCAGTAAAAGTATTGCATGCGGTACAATAAACCAAAGTCCAAGTAGGCAGCAGTGACTGGGCAGCTATCAGTCAATAATGAGACACTCCACAGGGGCATTGTTCTGTCTGCCCCAGGATGACTCATCAGCCACACTCACTGCCCACTGTTTT
>R:FOXA1-ChMod_chr16:78318895-78319032_[chr16:78318878-78319049]:079
TGATCTTTCTGAAATAGGCATGCATGTAATGATGATGTCATTAATGCTTGGCTAGCTGGTGGACTTAAACCCAGAGGGCACTTCTGAAAAGGGGCAAAGTGCATCTGCTTCTGCTTTGTTTATAGACTGTCAGCCTTGGATCTGTCACTCCCTCAGAAGGGAAGGATTGAG
>R:HNF4A-ChMod_chr5:137828875-137829045_[chr5:137828874-137829045]:081
ACAAACAGGGACTGGATCTCAGCACAGAGGGCTGCCAGCAACAGTTCCCGAGCCCCCTCCCCCCATGTTCCAGCAGGACAGCTGTCACAAAGTCCAGCTTTCTGCTGGGGAGGAGACAAGCAAGTCCCCATGTGGCCAGCTAGACCCGCCTGTGAGCCTGTGATTGTTCTG
>R:HNF4A-NoMod_chrY:18213828-18213963_[chrY:18213810-18213981]:029
TTCTTCCTGACAAAGTGACAGCCTAAAAGATCAGATTGCAGCCTAGTTAAGGAGGCAAAGTCCACTACAAAGAGGCCTTCCTGTGTAACTAGCAAGGGTCATGTATACACAGTAGGCATCAGTGAGCACATTGCTTTTCTTTTTTGGACATACTTAGTTAAGGAAATATGC
>A:HNF4A-ChMod_chr10:72112555-72112707_[chr10:72112545-72112716]:010
CCATTTTTAAATGTACAGTTCAGTAGCTTTAAGTATATTTACATTGTTGTGCAATCAACTAATCTCCAGGACTTTTGCATCTTGCGAAACGGAAACTCTTTACTTGTTAACCCCCTATTTTCCCATCCCCCAGCTGCTGGCAACCACAGAACATTATAAACTTTTTTCCAG

If I look the head of the label_rmIllegaChars.txt I got the following

head MPRAflow_tests/Assoc_Basic/work/3e/3256d22213084246f349db64782912/label_rmIllegalChars.txt
R:FOXA1-ChMod_chr7:32709843-32710013__chr7:32709842-32710013_:012       na
R:FOXA1-ChMod_chr16:78318895-78319032__chr16:78318878-78319049_:079     na
R:HNF4A-ChMod_chr5:137828875-137829045__chr5:137828874-137829045_:081   na
R:HNF4A-NoMod_chrY:18213828-18213963__chrY:18213810-18213981_:029       na
A:HNF4A-ChMod_chr10:72112555-72112707__chr10:72112545-72112716_:010     na
R:FOXA1-NoMod_chr8:30358109-30358253__chr8:30358095-30358266_:041       na
A:HNF4A-ChMod_chr5:82272787-82272893__chr5:82272754-82272925_:006       na
R:EP300-NoMod_chr3:57741879-57742050__chr3:57741879-57742050_:078       na
A:HNF4A-ChMod_chr9:111538379-111538538__chr9:111538373-111538544_:087   na
A:HNF4A-NoMod_chr5:125808085-125808153__chr5:125808033-125808204_:098   na

And finally my design_rmIllegalChars.fa if empty.

Regards, Sebastien

vagarwal87 commented 3 years ago

+1 I'm getting the same problem on my end...an empty design_rmIllegalChars.fa file and then downstream problems as a result.

visze commented 3 years ago

Ok. I found the issue. Thanks a lot for your help. can you try the new bugfix version 2.3.1?

xunchen85 commented 3 years ago

Hi Max,

It works and thanks for fixing the bug.

Thanks, Xun