search

smithlabcode / falco

A C++ drop-in replacement of FastQC to assess the quality of sequence read data
https://falco.readthedocs.io
GNU General Public License v3.0
90 stars 10 forks source link

adapter too long. Maximum adapter size is 32bp #23

Closed Shelestova-Anastasia closed 2 years ago

Shelestova-Anastasia commented 2 years ago

Falco version 0.3.0.

Hello! We want to switch to falco from fastqc. We are using bgi adapters. There is an adapter with length = 42. There was no any problems to use it in fasqc.

With falco I receive the error: adapter too long. Maximum adapter size is 32bp: AAGTCGGATCGTAGCCATGTCGTTCTGTGAGCCAAGGAGTTG

I see 32 is hardcoded adapter size limit. Why?