search

snugel / cas-offinder

An ultrafast and versatile algorithm that searches for potential off-target sites of CRISPR/Cas-derived RNA-guided endonucleases.
Other
85 stars 27 forks source link

Looks like a bug with .2bit input #7

Closed brownmk closed 8 years ago

brownmk commented 8 years ago

test.tar.gz

I have one target sequence in t.fa I create t.2bit using: faToTwoBit t.fa t.2bit The query sequence is taken from the target sequence. If I run: cas-offinder t.fa.in C t.fa.ou, I get the correct output, where it finds an exact match. ATGGCCAACACTCACCTTCACGG chr5:64476990-64477249 234 ATGGCCAACACTCACCTTCACGG - 0 If I run: cas-offinder t.2bit.in C t.2bit.ou, I get a wrong output, which finds a mismatch that does not exist. ATGGCCAACACTCACCTTCACGG chr5:64476990-64477249 234 cTGGCCAACACTCACCTTCACGG - 1

Seems like a bug associated with the 2bit input format. Thanks!

pjb7687 commented 8 years ago

Hello, I fixed the bug in master/development branch. This only happens when the length of sequence is not divided by 4, then the last 3, 2 or 1 bases would be wrong. Could you test it again? Thank you for your report!

brownmk commented 8 years ago

Thank you so much for the speedy fix! Works! I notice the changes and fixed were still on the development branch, not merged onto the master branch. Wonder if you consider them mature enough for the master? We can close the two issue threads, thank you again!

pjb7687 commented 8 years ago

Nope, the patch is firstly applied to master branch and then merged into develop. We will also release a bug patched release soon.

brownmk commented 8 years ago

When I downloaded the master branch yesterday, the code did not take a sequence file (in the first line of the t.2bit.in file) (it is still expecting a directory), so it seems earlier changes you made to the development branch was still in development.

On Thu, Aug 11, 2016 at 4:21 AM, Jeongbin Park notifications@github.com wrote:

Nope, the patch is firstly applied to master branch and then merged into develop. We will also release a bug patched release soon.

— You are receiving this because you authored the thread. Reply to this email directly, view it on GitHub https://github.com/snugel/cas-offinder/issues/7#issuecomment-239134429, or mute the thread https://github.com/notifications/unsubscribe-auth/AGU_FULKG5E4310pTXODL1T7hw9FVeBfks5qewXVgaJpZM4Jgmf_ .

pjb7687 commented 8 years ago

I released Cas-OFFinder 2.4. All changes were included in the master branch now.