search

soedinglab / plass

sensitive and precise assembly of short sequencing reads
https://plass.mmseqs.com
GNU General Public License v3.0
132 stars 14 forks source link

missing handling of small number of input reads #26

Open mr-eyes opened 4 years ago

mr-eyes commented 4 years ago

Expected Behavior

Throw an exception or end the program if the number of reads is small that it will fail to be assembled.

Current Behavior

Entered an infinite loop running on 24 threads (Different from the provided --threads parameter).

Steps to Reproduce (for bugs)

Create fastq files

R1.fastq ```text @SRR11015356.20904790 AGGGAACCAACTACAGACTGGGGGGACAACTCAGTGGTTAGGGTCACGTGTTCTTCTTGTGGCGGATGAGGGTTGGGATCCCAGAACCCACATGGGAGTCTCCAACCACCTGTAACTCTAGTTCCAGGCGACCCGATGATGGCCACCTCTG + ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? @SRR11015356.20907155 AGGGAACCAACTACAGACTGGGGGGACAACTCAGTGGTTAGGGTCACGTGTTCTTCTTGTGGCGGATGAGGGTTGGGATCCCAGAACCCACATGGGAGTCTCCAACCACCTGTAACTCTAGTTCCAGGCGACCCGATGATGGCCACCTCTG + ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ```
R2.fastq ```text @SRR11015356.20904790 TTTTGAAGCCACTATATGATCCAGAATGAAACTGTAGGAAACCAAGCTCCAGCCTAAAAAAGCCTCATCAATTTTTTTAAAAGAATTTTGTTTTTAGGTTTATGTTTTTATTTTGTGTGCAAGAGAGTTTTTCCTGCCTGTGTGTATGAGC + ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? @SRR11015356.20907155 TTTTGAAGCCACTATATGATCCAGAATGAAACTGTAGGAAACCAAGCTCCAGCCTAAAAAAGCCTCATCAATTTTTTTAAAAGAATTTTGTTTTTAGGTTTATGTTTTTATTTTGTGTGCAAGAGAGTTTTTCCTGCCTGTGTGTATGAGC + ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ```

Plass Output (for bugs)

Plass Output Log ```text MMseqs Version: 3.764a3 Check for circular sequences true Minimum contig length 1000 Clustering threshold 0.97 Number search iterations 12 Remove temporary files false Delete temporary files incremental 1 MPI runner Substitution matrix nucl:nucleotide.out,aa:blosum62.out Alphabet size 5 Seq. id. threshold 0.97 K-mers per sequence 60 scale k-mers per sequence 0.1 Adjust k-mer length false Mask residues 0 Mask lower case residues 0 Coverage mode 0 K-mer size 22 Coverage threshold 0 Max sequence length 65535 Shift hash 5 Split memory limit 0 Include only extendable true Skip repeating k-mers true Threads 2 Compressed 0 Verbosity 3 Rescore mode 3 Allow wrapped scoring false Remove hits by seq. id. and coverage false E-value threshold 1e-05 Add backtrace false Min. alignment length 0 Seq. id. mode 0 Include identical seq. id. false Sort results 0 Preload mode 0 Chop Cycle true Temporary folder tmp does not exist or is not a directory. Created directory tmp PAIRED END MODE mergereads R1.fastq R2.fastq /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/nucl_reads -v 3 Start merging reads. Time for merging to nucl_reads: 0h 0m 0s 0ms Time for merging to nucl_reads_h: 0h 0m 0s 0ms Done. Time for processing: 0h 0m 0s 0ms STEP: 0 kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/nucl_reads /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_0 --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 0 -k 22 -c 0 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 1 --ignore-multi-kmer 1 --threads 2 --compressed 0 -v 3 kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/nucl_reads /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_0 --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 0 -k 22 -c 0 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 1 --ignore-multi-kmer 1 --threads 2 --compressed 0 -v 3 Database size: 4 type: Nucleotide Estimated memory consumption 0 MB Generate k-mers list for 1 split [=================================================================] 100.00% 4 0s 0ms Adjusted k-mer length 22 Sort kmer 0h 0m 0s 0ms Sort by rep. sequence 0h 0m 0s 0ms Time for fill: 0h 0m 0s 0ms Time for merging to pref_0: 0h 0m 0s 0ms Time for processing: 0h 0m 0s 1ms rescorediagonal /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/nucl_reads /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/nucl_reads /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_0 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_0 --sub-mat nucl:nucleotide.out,aa:blosum62.out --rescore-mode 3 --wrapped-scoring 0 --filter-hits 0 -e 1e-05 -c 0 -a 0 --cov-mode 0 --min-seq-id 0.97 --min-aln-len 0 --seq-id-mode 0 --add-self-matches 0 --sort-results 0 --db-load-mode 0 --threads 2 --compressed 0 -v 3 [=================================================================] 100.00% 4 0s 0ms Time for merging to aln_0: 0h 0m 0s 0ms=====> ] 66.67% 3 eta 0s Time for processing: 0h 0m 0s 1ms assembleresults /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/nucl_reads /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_0 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_0 --min-seq-id 0.97 --max-seq-len 65535 --threads 2 -v 3 --rescore-mode 3 Compute assembly. [=================================================================] 100.00% 4 0s 0ms Time for merging to assembly_0: 0h 0m 0s 0ms Done. Time for processing: 0h 0m 0s 3ms cyclecheck /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_0 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_0_cycle --max-seq-len 65535 --chop-cycle 1 --threads 2 -v 3 Time for merging to assembly_0_cycle: 0h 0m 0s 0ms Time for processing: 0h 0m 0s 0ms STEP: 1 kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_0_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_1 --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 0 -k 22 -c 0 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 1 --ignore-multi-kmer 1 --threads 2 --compressed 0 -v 3 kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_0_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_1 --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 0 -k 22 -c 0 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 1 --ignore-multi-kmer 1 --threads 2 --compressed 0 -v 3 Database size: 4 type: Nucleotide Estimated memory consumption 0 MB Generate k-mers list for 1 split [=================================================================] 100.00% 4 0s 0ms Adjusted k-mer length 22 Sort kmer 0h 0m 0s 0ms Sort by rep. sequence 0h 0m 0s 0ms Time for fill: 0h 0m 0s 0ms Time for merging to pref_1: 0h 0m 0s 0ms Time for processing: 0h 0m 0s 2ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_0 Time for processing: 0h 0m 0s 0ms rescorediagonal /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_0_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_0_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_1 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_1 --sub-mat nucl:nucleotide.out,aa:blosum62.out --rescore-mode 3 --wrapped-scoring 0 --filter-hits 0 -e 1e-05 -c 0 -a 0 --cov-mode 0 --min-seq-id 0.97 --min-aln-len 0 --seq-id-mode 0 --add-self-matches 0 --sort-results 0 --db-load-mode 0 --threads 2 --compressed 0 -v 3 [=================================================================] 100.00% 4 0s 0ms Time for merging to aln_1: 0h 0m 0s 0ms Time for processing: 0h 0m 0s 1ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_0 Time for processing: 0h 0m 0s 0ms assembleresults /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_0_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_1 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_1 --min-seq-id 0.97 --max-seq-len 65535 --threads 2 -v 3 --rescore-mode 3 Compute assembly. [=================================================================] 100.00% 4 0s 1ms Time for merging to assembly_1: 0h 0m 0s 0ms Done. Time for processing: 0h 0m 0s 5ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_0_noneCycle Time for processing: 0h 0m 0s 0ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_0 Time for processing: 0h 0m 0s 0ms cyclecheck /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_1 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_1_cycle --max-seq-len 65535 --chop-cycle 1 --threads 2 -v 3 Time for merging to assembly_1_cycle: 0h 0m 0s 0ms Time for processing: 0h 0m 0s 1ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_0_cycle Time for processing: 0h 0m 0s 0ms STEP: 2 kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_1_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_2 --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 0 -k 22 -c 0 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 1 --ignore-multi-kmer 1 --threads 2 --compressed 0 -v 3 kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_1_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_2 --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 0 -k 22 -c 0 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 1 --ignore-multi-kmer 1 --threads 2 --compressed 0 -v 3 Database size: 4 type: Nucleotide Estimated memory consumption 0 MB Generate k-mers list for 1 split [=================================================================] 100.00% 4 0s 0ms Adjusted k-mer length 22 Sort kmer 0h 0m 0s 0ms Sort by rep. sequence 0h 0m 0s 0ms Time for fill: 0h 0m 0s 0ms Time for merging to pref_2: 0h 0m 0s 0ms Time for processing: 0h 0m 0s 1ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_1 Time for processing: 0h 0m 0s 0ms rescorediagonal /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_1_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_1_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_2 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_2 --sub-mat nucl:nucleotide.out,aa:blosum62.out --rescore-mode 3 --wrapped-scoring 0 --filter-hits 0 -e 1e-05 -c 0 -a 0 --cov-mode 0 --min-seq-id 0.97 --min-aln-len 0 --seq-id-mode 0 --add-self-matches 0 --sort-results 0 --db-load-mode 0 --threads 2 --compressed 0 -v 3 [=================================================================] 100.00% 4 0s 0ms Time for merging to aln_2: 0h 0m 0s 0ms Time for processing: 0h 0m 0s 1ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_1 Time for processing: 0h 0m 0s 0ms assembleresults /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_1_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_2 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_2 --min-seq-id 0.97 --max-seq-len 65535 --threads 2 -v 3 --rescore-mode 3 Compute assembly. [=================================================================] 100.00% 4 0s 0ms Time for merging to assembly_2: 0h 0m 0s 0ms Done. Time for processing: 0h 0m 0s 1ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_1_noneCycle Time for processing: 0h 0m 0s 0ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_1 Time for processing: 0h 0m 0s 0ms cyclecheck /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_2 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_2_cycle --max-seq-len 65535 --chop-cycle 1 --threads 2 -v 3 Time for merging to assembly_2_cycle: 0h 0m 0s 0ms Time for processing: 0h 0m 0s 0ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_1_cycle Time for processing: 0h 0m 0s 0ms STEP: 3 kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_2_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_3 --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 0 -k 22 -c 0 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 1 --ignore-multi-kmer 1 --threads 2 --compressed 0 -v 3 kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_2_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_3 --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 0 -k 22 -c 0 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 1 --ignore-multi-kmer 1 --threads 2 --compressed 0 -v 3 Database size: 4 type: Nucleotide Estimated memory consumption 0 MB Generate k-mers list for 1 split [=================================================================] 100.00% 4 0s 0ms Adjusted k-mer length 22 Sort kmer 0h 0m 0s 0ms Sort by rep. sequence 0h 0m 0s 0ms Time for fill: 0h 0m 0s 0ms Time for merging to pref_3: 0h 0m 0s 0ms Time for processing: 0h 0m 0s 1ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_2 Time for processing: 0h 0m 0s 0ms rescorediagonal /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_2_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_2_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_3 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_3 --sub-mat nucl:nucleotide.out,aa:blosum62.out --rescore-mode 3 --wrapped-scoring 0 --filter-hits 0 -e 1e-05 -c 0 -a 0 --cov-mode 0 --min-seq-id 0.97 --min-aln-len 0 --seq-id-mode 0 --add-self-matches 0 --sort-results 0 --db-load-mode 0 --threads 2 --compressed 0 -v 3 [=================================================================] 100.00% 4 0s 0ms Time for merging to aln_3: 0h 0m 0s 0ms ] 33.33% 2 eta 0s Time for processing: 0h 0m 0s 1ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_2 Time for processing: 0h 0m 0s 0ms assembleresults /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_2_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_3 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_3 --min-seq-id 0.97 --max-seq-len 65535 --threads 2 -v 3 --rescore-mode 3 Compute assembly. [=================================================================] 100.00% 4 0s 0ms Time for merging to assembly_3: 0h 0m 0s 0ms Done. Time for processing: 0h 0m 0s 1ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_2_noneCycle Time for processing: 0h 0m 0s 0ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_2 Time for processing: 0h 0m 0s 0ms cyclecheck /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_3 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_3_cycle --max-seq-len 65535 --chop-cycle 1 --threads 2 -v 3 Time for merging to assembly_3_cycle: 0h 0m 0s 0ms Time for processing: 0h 0m 0s 0ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_2_cycle Time for processing: 0h 0m 0s 0ms STEP: 4 kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_3_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_4 --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 0 -k 22 -c 0 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 1 --ignore-multi-kmer 1 --threads 2 --compressed 0 -v 3 kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_3_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_4 --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 0 -k 22 -c 0 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 1 --ignore-multi-kmer 1 --threads 2 --compressed 0 -v 3 Database size: 4 type: Nucleotide Estimated memory consumption 0 MB Generate k-mers list for 1 split [=================================================================] 100.00% 4 0s 0ms Adjusted k-mer length 22 Sort kmer 0h 0m 0s 0ms Sort by rep. sequence 0h 0m 0s 0ms Time for fill: 0h 0m 0s 0ms Time for merging to pref_4: 0h 0m 0s 0ms Time for processing: 0h 0m 0s 1ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_3 Time for processing: 0h 0m 0s 0ms rescorediagonal /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_3_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_3_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_4 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_4 --sub-mat nucl:nucleotide.out,aa:blosum62.out --rescore-mode 3 --wrapped-scoring 0 --filter-hits 0 -e 1e-05 -c 0 -a 0 --cov-mode 0 --min-seq-id 0.97 --min-aln-len 0 --seq-id-mode 0 --add-self-matches 0 --sort-results 0 --db-load-mode 0 --threads 2 --compressed 0 -v 3 [=================================================================] 100.00% 4 0s 0ms Time for merging to aln_4: 0h 0m 0s 0ms Time for processing: 0h 0m 0s 1ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_3 Time for processing: 0h 0m 0s 0ms assembleresults /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_3_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_4 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_4 --min-seq-id 0.97 --max-seq-len 65535 --threads 2 -v 3 --rescore-mode 3 Compute assembly. [=================================================================] 100.00% 4 0s 0ms Time for merging to assembly_4: 0h 0m 0s 0ms Done. Time for processing: 0h 0m 0s 1ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_3_noneCycle Time for processing: 0h 0m 0s 0ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_3 Time for processing: 0h 0m 0s 0ms cyclecheck /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_4 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_4_cycle --max-seq-len 65535 --chop-cycle 1 --threads 2 -v 3 Time for merging to assembly_4_cycle: 0h 0m 0s 0ms Time for processing: 0h 0m 0s 1ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_3_cycle Time for processing: 0h 0m 0s 0ms STEP: 5 kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_4_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_5 --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 0 -k 22 -c 0 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 1 --ignore-multi-kmer 1 --threads 2 --compressed 0 -v 3 kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_4_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_5 --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 0 -k 22 -c 0 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 1 --ignore-multi-kmer 1 --threads 2 --compressed 0 -v 3 Database size: 4 type: Nucleotide Estimated memory consumption 0 MB Generate k-mers list for 1 split [=================================================================] 100.00% 4 0s 0ms Adjusted k-mer length 22 Sort kmer 0h 0m 0s 0ms Sort by rep. sequence 0h 0m 0s 0ms Time for fill: 0h 0m 0s 0ms Time for merging to pref_5: 0h 0m 0s 0ms Time for processing: 0h 0m 0s 1ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_4 Time for processing: 0h 0m 0s 0ms rescorediagonal /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_4_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_4_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_5 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_5 --sub-mat nucl:nucleotide.out,aa:blosum62.out --rescore-mode 3 --wrapped-scoring 0 --filter-hits 0 -e 1e-05 -c 0 -a 0 --cov-mode 0 --min-seq-id 0.97 --min-aln-len 0 --seq-id-mode 0 --add-self-matches 0 --sort-results 0 --db-load-mode 0 --threads 2 --compressed 0 -v 3 [=================================================================] 100.00% 4 0s 0ms Time for merging to aln_5: 0h 0m 0s 0ms Time for processing: 0h 0m 0s 1ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_4 Time for processing: 0h 0m 0s 0ms assembleresults /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_4_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_5 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_5 --min-seq-id 0.97 --max-seq-len 65535 --threads 2 -v 3 --rescore-mode 3 Compute assembly. [=================================================================] 100.00% 4 0s 0ms Time for merging to assembly_5: 0h 0m 0s 0ms Done. Time for processing: 0h 0m 0s 1ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_4_noneCycle Time for processing: 0h 0m 0s 0ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_4 Time for processing: 0h 0m 0s 0ms cyclecheck /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_5 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_5_cycle --max-seq-len 65535 --chop-cycle 1 --threads 2 -v 3 Time for merging to assembly_5_cycle: 0h 0m 0s 0ms Time for processing: 0h 0m 0s 0ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_4_cycle Time for processing: 0h 0m 0s 0ms STEP: 6 kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_5_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_6 --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 0 -k 22 -c 0 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 1 --ignore-multi-kmer 1 --threads 2 --compressed 0 -v 3 kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_5_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_6 --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 0 -k 22 -c 0 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 1 --ignore-multi-kmer 1 --threads 2 --compressed 0 -v 3 Database size: 4 type: Nucleotide Estimated memory consumption 0 MB Generate k-mers list for 1 split [=================================================================] 100.00% 4 0s 0ms Adjusted k-mer length 22 Sort kmer 0h 0m 0s 0ms Sort by rep. sequence 0h 0m 0s 0ms Time for fill: 0h 0m 0s 0ms Time for merging to pref_6: 0h 0m 0s 0ms Time for processing: 0h 0m 0s 2ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_5 Time for processing: 0h 0m 0s 0ms rescorediagonal /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_5_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_5_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_6 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_6 --sub-mat nucl:nucleotide.out,aa:blosum62.out --rescore-mode 3 --wrapped-scoring 0 --filter-hits 0 -e 1e-05 -c 0 -a 0 --cov-mode 0 --min-seq-id 0.97 --min-aln-len 0 --seq-id-mode 0 --add-self-matches 0 --sort-results 0 --db-load-mode 0 --threads 2 --compressed 0 -v 3 [=================================================================] 100.00% 4 0s 0ms Time for merging to aln_6: 0h 0m 0s 0ms Time for processing: 0h 0m 0s 1ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_5 Time for processing: 0h 0m 0s 0ms assembleresults /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_5_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_6 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_6 --min-seq-id 0.97 --max-seq-len 65535 --threads 2 -v 3 --rescore-mode 3 Compute assembly. [=================================================================] 100.00% 4 0s 0ms Time for merging to assembly_6: 0h 0m 0s 0ms Done. Time for processing: 0h 0m 0s 2ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_5_noneCycle Time for processing: 0h 0m 0s 0ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_5 Time for processing: 0h 0m 0s 0ms cyclecheck /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_6 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_6_cycle --max-seq-len 65535 --chop-cycle 1 --threads 2 -v 3 Time for merging to assembly_6_cycle: 0h 0m 0s 0ms Time for processing: 0h 0m 0s 0ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_5_cycle Time for processing: 0h 0m 0s 0ms STEP: 7 kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_6_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_7 --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 0 -k 22 -c 0 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 1 --ignore-multi-kmer 1 --threads 2 --compressed 0 -v 3 kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_6_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_7 --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 0 -k 22 -c 0 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 1 --ignore-multi-kmer 1 --threads 2 --compressed 0 -v 3 Database size: 4 type: Nucleotide Estimated memory consumption 0 MB Generate k-mers list for 1 split [=================================================================] 100.00% 4 0s 0ms Adjusted k-mer length 22 Sort kmer 0h 0m 0s 0ms Sort by rep. sequence 0h 0m 0s 0ms Time for fill: 0h 0m 0s 0ms Time for merging to pref_7: 0h 0m 0s 0ms Time for processing: 0h 0m 0s 1ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_6 Time for processing: 0h 0m 0s 0ms rescorediagonal /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_6_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_6_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_7 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_7 --sub-mat nucl:nucleotide.out,aa:blosum62.out --rescore-mode 3 --wrapped-scoring 0 --filter-hits 0 -e 1e-05 -c 0 -a 0 --cov-mode 0 --min-seq-id 0.97 --min-aln-len 0 --seq-id-mode 0 --add-self-matches 0 --sort-results 0 --db-load-mode 0 --threads 2 --compressed 0 -v 3 [=================================================================] 100.00% 4 0s 0ms Time for merging to aln_7: 0h 0m 0s 0ms Time for processing: 0h 0m 0s 1ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_6 Time for processing: 0h 0m 0s 0ms assembleresults /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_6_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_7 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_7 --min-seq-id 0.97 --max-seq-len 65535 --threads 2 -v 3 --rescore-mode 3 Compute assembly. [=================================================================] 100.00% 4 0s 0ms Time for merging to assembly_7: 0h 0m 0s 0ms Done. Time for processing: 0h 0m 0s 0ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_6_noneCycle Time for processing: 0h 0m 0s 0ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_6 Time for processing: 0h 0m 0s 0ms cyclecheck /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_7 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_7_cycle --max-seq-len 65535 --chop-cycle 1 --threads 2 -v 3 Time for merging to assembly_7_cycle: 0h 0m 0s 0ms Time for processing: 0h 0m 0s 2ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_6_cycle Time for processing: 0h 0m 0s 0ms STEP: 8 kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_7_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_8 --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 0 -k 22 -c 0 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 1 --ignore-multi-kmer 1 --threads 2 --compressed 0 -v 3 kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_7_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_8 --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 0 -k 22 -c 0 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 1 --ignore-multi-kmer 1 --threads 2 --compressed 0 -v 3 Database size: 4 type: Nucleotide Estimated memory consumption 0 MB Generate k-mers list for 1 split [=================================================================] 100.00% 4 0s 0ms Adjusted k-mer length 22 Sort kmer 0h 0m 0s 0ms Sort by rep. sequence 0h 0m 0s 0ms Time for fill: 0h 0m 0s 0ms Time for merging to pref_8: 0h 0m 0s 0ms Time for processing: 0h 0m 0s 1ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_7 Time for processing: 0h 0m 0s 0ms rescorediagonal /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_7_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_7_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_8 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_8 --sub-mat nucl:nucleotide.out,aa:blosum62.out --rescore-mode 3 --wrapped-scoring 0 --filter-hits 0 -e 1e-05 -c 0 -a 0 --cov-mode 0 --min-seq-id 0.97 --min-aln-len 0 --seq-id-mode 0 --add-self-matches 0 --sort-results 0 --db-load-mode 0 --threads 2 --compressed 0 -v 3 [=================================================================] 100.00% 4 0s 0ms Time for merging to aln_8: 0h 0m 0s 0ms Time for processing: 0h 0m 0s 1ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_7 Time for processing: 0h 0m 0s 0ms assembleresults /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_7_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_8 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_8 --min-seq-id 0.97 --max-seq-len 65535 --threads 2 -v 3 --rescore-mode 3 Compute assembly. [=================================================================] 100.00% 4 0s 0ms Time for merging to assembly_8: 0h 0m 0s 0ms Done. Time for processing: 0h 0m 0s 1ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_7_noneCycle Time for processing: 0h 0m 0s 0ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_7 Time for processing: 0h 0m 0s 0ms cyclecheck /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_8 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_8_cycle --max-seq-len 65535 --chop-cycle 1 --threads 2 -v 3 Time for merging to assembly_8_cycle: 0h 0m 0s 0ms Time for processing: 0h 0m 0s 1ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_7_cycle Time for processing: 0h 0m 0s 0ms STEP: 9 kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_8_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_9 --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 0 -k 22 -c 0 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 1 --ignore-multi-kmer 1 --threads 2 --compressed 0 -v 3 kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_8_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_9 --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 0 -k 22 -c 0 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 1 --ignore-multi-kmer 1 --threads 2 --compressed 0 -v 3 Database size: 4 type: Nucleotide Estimated memory consumption 0 MB Generate k-mers list for 1 split [=================================================================] 100.00% 4 0s 0ms Adjusted k-mer length 22 Sort kmer 0h 0m 0s 0ms Sort by rep. sequence 0h 0m 0s 0ms Time for fill: 0h 0m 0s 0ms Time for merging to pref_9: 0h 0m 0s 0ms Time for processing: 0h 0m 0s 1ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_8 Time for processing: 0h 0m 0s 0ms rescorediagonal /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_8_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_8_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_9 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_9 --sub-mat nucl:nucleotide.out,aa:blosum62.out --rescore-mode 3 --wrapped-scoring 0 --filter-hits 0 -e 1e-05 -c 0 -a 0 --cov-mode 0 --min-seq-id 0.97 --min-aln-len 0 --seq-id-mode 0 --add-self-matches 0 --sort-results 0 --db-load-mode 0 --threads 2 --compressed 0 -v 3 [=================================================================] 100.00% 4 0s 0ms Time for merging to aln_9: 0h 0m 0s 0ms Time for processing: 0h 0m 0s 2ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_8 Time for processing: 0h 0m 0s 0ms assembleresults /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_8_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_9 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_9 --min-seq-id 0.97 --max-seq-len 65535 --threads 2 -v 3 --rescore-mode 3 Compute assembly. [=================================================================] 100.00% 4 0s 0ms Time for merging to assembly_9: 0h 0m 0s 0ms Done. Time for processing: 0h 0m 0s 0ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_8_noneCycle Time for processing: 0h 0m 0s 0ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_8 Time for processing: 0h 0m 0s 0ms cyclecheck /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_9 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_9_cycle --max-seq-len 65535 --chop-cycle 1 --threads 2 -v 3 Time for merging to assembly_9_cycle: 0h 0m 0s 0ms Time for processing: 0h 0m 0s 1ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_8_cycle Time for processing: 0h 0m 0s 0ms STEP: 10 kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_9_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_10 --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 0 -k 22 -c 0 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 1 --ignore-multi-kmer 1 --threads 2 --compressed 0 -v 3 kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_9_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_10 --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 0 -k 22 -c 0 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 1 --ignore-multi-kmer 1 --threads 2 --compressed 0 -v 3 Database size: 4 type: Nucleotide Estimated memory consumption 0 MB Generate k-mers list for 1 split [=================================================================] 100.00% 4 0s 0ms Adjusted k-mer length 22 Sort kmer 0h 0m 0s 0ms Sort by rep. sequence 0h 0m 0s 0ms Time for fill: 0h 0m 0s 0ms Time for merging to pref_10: 0h 0m 0s 0ms Time for processing: 0h 0m 0s 1ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_9 Time for processing: 0h 0m 0s 0ms rescorediagonal /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_9_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_9_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_10 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_10 --sub-mat nucl:nucleotide.out,aa:blosum62.out --rescore-mode 3 --wrapped-scoring 0 --filter-hits 0 -e 1e-05 -c 0 -a 0 --cov-mode 0 --min-seq-id 0.97 --min-aln-len 0 --seq-id-mode 0 --add-self-matches 0 --sort-results 0 --db-load-mode 0 --threads 2 --compressed 0 -v 3 [=================================================================] 100.00% 4 0s 0ms Time for merging to aln_10: 0h 0m 0s 0ms Time for processing: 0h 0m 0s 1ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_9 Time for processing: 0h 0m 0s 0ms assembleresults /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_9_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_10 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_10 --min-seq-id 0.97 --max-seq-len 65535 --threads 2 -v 3 --rescore-mode 3 Compute assembly. [=================================================================] 100.00% 4 0s 0ms Time for merging to assembly_10: 0h 0m 0s 0ms Done. Time for processing: 0h 0m 0s 1ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_9_noneCycle Time for processing: 0h 0m 0s 0ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_9 Time for processing: 0h 0m 0s 0ms cyclecheck /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_10 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_10_cycle --max-seq-len 65535 --chop-cycle 1 --threads 2 -v 3 Time for merging to assembly_10_cycle: 0h 0m 0s 0ms Time for processing: 0h 0m 0s 1ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_9_cycle Time for processing: 0h 0m 0s 0ms STEP: 11 kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_10_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_11 --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 0 -k 22 -c 0 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 1 --ignore-multi-kmer 1 --threads 2 --compressed 0 -v 3 kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_10_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_11 --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 0 -k 22 -c 0 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 1 --ignore-multi-kmer 1 --threads 2 --compressed 0 -v 3 Database size: 4 type: Nucleotide Estimated memory consumption 0 MB Generate k-mers list for 1 split [=================================================================] 100.00% 4 0s 0ms Adjusted k-mer length 22 Sort kmer 0h 0m 0s 0ms Sort by rep. sequence 0h 0m 0s 0ms Time for fill: 0h 0m 0s 0ms Time for merging to pref_11: 0h 0m 0s 0ms Time for processing: 0h 0m 0s 1ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_10 Time for processing: 0h 0m 0s 0ms rescorediagonal /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_10_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_10_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/pref_11 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_11 --sub-mat nucl:nucleotide.out,aa:blosum62.out --rescore-mode 3 --wrapped-scoring 0 --filter-hits 0 -e 1e-05 -c 0 -a 0 --cov-mode 0 --min-seq-id 0.97 --min-aln-len 0 --seq-id-mode 0 --add-self-matches 0 --sort-results 0 --db-load-mode 0 --threads 2 --compressed 0 -v 3 [=================================================================] 100.00% 4 0s 0ms Time for merging to aln_11: 0h 0m 0s 0ms Time for processing: 0h 0m 0s 2ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_10 Time for processing: 0h 0m 0s 0ms assembleresults /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_10_noneCycle /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/aln_11 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_11 --min-seq-id 0.97 --max-seq-len 65535 --threads 2 -v 3 --rescore-mode 3 Compute assembly. [=================================================================] 100.00% 4 0s 0ms Time for merging to assembly_11: 0h 0m 0s 0ms Done. Time for processing: 0h 0m 0s 1ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_10_noneCycle Time for processing: 0h 0m 0s 0ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_10 Time for processing: 0h 0m 0s 0ms cyclecheck /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_11 /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_11_cycle --max-seq-len 65535 --chop-cycle 1 --threads 2 -v 3 Time for merging to assembly_11_cycle: 0h 0m 0s 0ms Time for processing: 0h 0m 0s 0ms rmdb /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_10_cycle Time for processing: 0h 0m 0s 0ms Tmp /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/clu_tmp folder does not exist or is not a directory. Create dir /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/clu_tmp linclust /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_final /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/clu /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/clu_tmp --alph-size 5 -k 22 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --min-seq-id 0.97 --cov-mode 1 -c 0.99 --wrapped-scoring 1 Set cluster mode GREEDY MEM. kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_final /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/clu_tmp/8372675225677313391/pref --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 1 -k 22 -c 0.99 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 0 --ignore-multi-kmer 0 --threads 4 --compressed 0 -v 3 kmermatcher /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_final /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/clu_tmp/8372675225677313391/pref --sub-mat nucl:nucleotide.out,aa:blosum62.out --alph-size 5 --min-seq-id 0.97 --kmer-per-seq 60 --kmer-per-seq-scale 0.1 --adjust-kmer-len 0 --mask 0 --mask-lower-case 0 --cov-mode 1 -k 22 -c 0.99 --max-seq-len 65535 --hash-shift 5 --split-memory-limit 0 --include-only-extendable 0 --ignore-multi-kmer 0 --threads 4 --compressed 0 -v 3 Database size: 0 type: Nucleotide Estimated memory consumption 0 MB Time for fill: 0h 0m 0s 0ms Time for merging to pref: 0h 0m 0s 0ms Time for processing: 0h 0m 0s 1ms rescorediagonal /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_final /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/assembly_final /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/clu_tmp/8372675225677313391/pref /home/mabuelanin/Downloads/bug_tmp/tmp/12805131151232307666/clu_tmp/8372675225677313391/pref_rescore1 --sub-mat nucl:nucleotide.out,aa:blosum62.out --rescore-mode 0 --wrapped-scoring 1 --filter-hits 0 -e 0.001 -c 0.99 -a 0 --cov-mode 1 --min-seq-id 0.97 --min-aln-len 0 --seq-id-mode 0 --add-self-matches 0 --sort-results 0 --db-load-mode 0 --threads 4 --compressed 0 -v 3 ```

Your Environment

Include as many relevant details about the environment you experienced the bug in.

martin-steinegger commented 4 years ago

@mr-eyes thanks for reporting this. This error seem to be fixed in the newest version of plass. Could you please retry it with the newest version?

mr-eyes commented 4 years ago

@martin-steinegger I think I'm already using the latest release via bioconda channel latest_release.

mr-eyes commented 4 years ago

@martin-steinegger I tried the latest static linux build and it's fixed, the version of it is the commit hash 63193c8d06e8876e652d4052fe30a0016a2e029a and it's working just fine. I'll use this one until releasing this version via conda.

Thank you,

mr-eyes commented 4 years ago

UPDATE: The issue still exists if the number of reads is 1. It enters an infinite loop when trying to assemble a single read (Which logically makes sense) but the problem in the infinite loop.

mr-eyes commented 4 years ago

Another noticed behavior regarding the multiprocessing, the internal clustering commands that runs at the end of the assembly to extract the representative sequences does not inherit the user-defined --threads. In an experiment, I run the assembly with --threads 32 but I found in the plass log the following line

clust --cluster-mode 3 --max-iterations 1000 --similarity-type 2 --threads 96 --compressed 0 -v 3
AnnSeidel commented 4 years ago

@mr-eyes The nuclassemble workflow itself is heavily under development at the moment. I fixed the problem that the --threads value was not passed to the redundancy workflow in general. But I guess the clust --cluster-mode 3 --max-iterations 1000 --similarity-type 2 --threads 96 --compress line was part of your first run, right? Because I noticed some problems with the redundancy reduction itself some weeks ago and took that part out from the nuclassemble provisionally until it is fixed. So there should be no automatic redundancy reduction in the current version of the nuclassemble workflow. If you want to reduce redundancy for now, you can use mmseqs cluster.

mr-eyes commented 4 years ago

@AnnSeidel Actually not, my first run was --threads 32. And the plass version of the current two issues is 63193c8d06e8876e652d4052fe30a0016a2e029a.

Integrating the clustering at the end of the pipeline is nice, and it would not be a problem running mmseqs cluster manually after the run (I'm doing this in the meantime).

To summarize this thread, we have two issues here.

  1. Handling the case when the user tries to assemble just one read, this will cause plass to enter an infinite loop running on 24 threads.
  2. The inheritance of the user-defined --threads in the plass nuclassemble in the internal invocation of the other processes. (I didn't try the protein mode).