search

songweizhi / MarkerMAG

Linking MAGs with 16S rRNA marker genes
GNU Affero General Public License v3.0
24 stars 2 forks source link

Mini-assembly not working #5

Open AlessioMilanese opened 2 years ago

AlessioMilanese commented 2 years ago

Hi,

Thanks for the nice tool. When I try to run this command:

MarkerMAG link -p test -marker reconstructed_16.fa -mag MAGs -x fa -r1 ETHSEQ0000005220.1.fq -r2 ETHSEQ0000005220.2.fq -t 8 -o output_test

I have the following error:

[2022-06-24 17:23:26] parameters for linking
 + mismatch:    2%
 + min_M_len:   45bp
 + min_M_pct:   35%
 + min_link_num_gnm:    9
 + min_link_num_ctg:    3
 + rd2_end_seq_len: 1000bp
 + max_short_cigar_pct: 75,85
[2022-06-24 17:23:26] parameters for estimating copy number
 + MAG_cov_subsample_pct:   25%
 + min_insert_size_16s: -1000bp
 + ignore_ends_len_16s: 150bp
 + ignore_lowest_pct:   25%
 + ignore_highest_pct:  25%
 + both_pair_mapped:    False
[2022-06-24 17:23:26] Rd1: identifying 16S rRNA genes in input MAGs with barrnap
[2022-06-24 17:23:32] Rd1: identify 16S rRNA genes in input MAGs finished
[2022-06-24 17:23:32] Rd1: removing 16S sequences at the end of MAG contigs
[2022-06-24 17:23:32] Rd1: remove 16S sequences at the end of MAG contigs finished
[2022-06-24 17:23:32] Rd1: quality control provided 16S rRNA gene sequences to:
[2022-06-24 17:23:32] Rd1: remove non-16S sequences (if any)
[2022-06-24 17:23:32] Rd1: cluster at 99% identity and keep only the longest one in each cluster
[2022-06-24 17:23:37] Rd1: qualified 16S rRNA gene sequences exported to: reconstructed_16_polished_min1200bp_c99.fa
[2022-06-24 17:23:38] Rd1: mapping input reads to marker genes with 8 cores (be patient!)
11455318 reads; of these:
  11455318 (100.00%) were unpaired; of these:
    11434701 (99.82%) aligned 0 times
    1864 (0.02%) aligned exactly 1 time
    18753 (0.16%) aligned >1 times
0.18% overall alignment rate
[2022-06-24 17:24:00] Rd1: sorting test_input_reads_to_16S.sam
[bam_sort_core] merging from 0 files and 8 in-memory blocks...
[2022-06-24 17:24:02] Rd1: calculating the number of lines per subset
[2022-06-24 17:24:02] Rd1: splitting sam file
[2022-06-24 17:24:04] Rd1: analysing mappping results with 8 threads
[2022-06-24 17:24:04] Rd1: removing splitted subsets from disk
[2022-06-24 17:24:04] Rd1: reading filtered alignments into dict
[2022-06-24 17:24:04] Rd1: extracting sequences of reads matched to 16S
[2022-06-24 17:24:07] Rd1: mapping extracted reads to input genomes
Unable to read file magic number
Unable to read file magic number
0 reads
0.00% overall alignment rate
[2022-06-24 17:24:31] Rd1: analysing mappping results
[2022-06-24 17:24:31] Rd1: processed 0.0k
[2022-06-24 17:24:31] Rd1: parsing MappingRecord dict to get linkages
[2022-06-24 17:24:31] Rd1: calculating pairwise 16S rRNA gene identities
[2022-06-24 17:24:33] Rd1: filtering linkages iteratively
[2022-06-24 17:24:33] Rd1: extracting linking reads for visualization
[2022-06-24 17:24:35] Rd1: visualizing 0 rd1 linkages with 8 threads
[2022-06-24 17:24:36] Rd2: get unlinked marker genes and genomes
[2022-06-24 17:24:36] Rd2: mapping input reads to the ends of contigs from unlinked genomes
11455318 reads; of these:
  11455318 (100.00%) were unpaired; of these:
    10775989 (94.07%) aligned 0 times
    647843 (5.66%) aligned exactly 1 time
    31486 (0.27%) aligned >1 times
5.93% overall alignment rate
[2022-06-24 17:25:18] Rd2: sorting mappping results
[bam_sort_core] merging from 0 files and 8 in-memory blocks...
[2022-06-24 17:25:21] Rd2: calculating the number of lines per subset
[2022-06-24 17:25:21] Rd2: splitting sam file
[2022-06-24 17:25:23] Rd2: reading in mappping results with 8 threads
[2022-06-24 17:25:24] Rd2: removing splitted subsets from disk
[2022-06-24 17:25:26] Rd2: running SPAdes on extracted reads
[2022-06-24 17:25:27] Mini-assembly not found! will report 1st round linkages only!
Traceback (most recent call last):
  File "/nfs/nas22/fs2202/biol_micro_sunagawa/Projects/EAN/NCCR_META_OMICS_EAN/data/raw/software/miniconda3/bin/MarkerMAG", line 134, in <module>
    link_16s.link_16s(args, config_dict)
  File "/nfs/nas22/fs2202/biol_micro_sunagawa/Projects/EAN/NCCR_META_OMICS_EAN/data/raw/software/miniconda3/lib/python3.9/site-packages/MarkerMAG/link_16s.py", line 4581, in link_16s
    for each_ctg_level_link in open(stats_GapFilling_ctg):
FileNotFoundError: [Errno 2] No such file or directory: 'output_test/test_rd2_wd/stats_GapFilling_ctg.txt'

And in the log file (test.log) I see:

[2022-06-24 17:25:26] Rd2: running SPAdes on extracted reads
[2022-06-24 17:25:26] spades.py --only-assembler -s output_test/test_rd2_wd/rd2_read_to_extract_flanking_both_R12_up.fa -o output_test/test_rd2_wd/mini_assembly_SPAdes_wd -t 8 -k 75,99,123 -m 1024 > output_test/test_rd2_wd/SPAdes_stdout.txt
[2022-06-24 17:25:27] Mini-assembly not found! will report 1st round linkages only!
Laura-Alex commented 2 years ago

Seconded. Am having the same problem, and was about to post : )

AlessioMilanese commented 2 years ago

Note: I realised that you need reads with identifiers ending with .1 and .2.

I used this command to have correct reads:

MarkerMAG rename_reads -r1 ETHSEQ0000005220.1.fq -r2 ETHSEQ0000005220.2.fq -p test -fq -t 4

And then run MarkerMAG on the new files, but I get the same error. I also tried to run directly with fasta file (instead of fastq) and get the same error.

songweizhi commented 2 years ago

Hi AlessioMilanese,

Thanks for using MarkerMAG, a new release (1.1.27) is available now, can you please update and see if the error still exist? Weizhi

AlessioMilanese commented 2 years ago

Hi @songweizhi

Thanks for checking and solving the problem. Seems to be working good now. For your information, this is what I got in the stdout:

[2022-07-04 09:43:43] parameters for linking
 + mismatch:    2%
 + min_M_len:   45bp
 + min_M_pct:   35%
 + min_link_num_gnm:    9
 + min_link_num_ctg:    3
 + rd2_end_seq_len: 1000bp
 + max_short_cigar_pct: 75,85
[2022-07-04 09:43:43] parameters for estimating copy number
 + MAG_cov_subsample_pct:   25%
 + min_insert_size_16s: -1000bp
 + ignore_ends_len_16s: 150bp
 + ignore_lowest_pct:   25%
 + ignore_highest_pct:  25%
 + both_pair_mapped:    False
[2022-07-04 09:43:43] Rd1: identifying 16S rRNA genes in input MAGs with barrnap
[2022-07-04 09:43:52] Rd1: identify 16S rRNA genes in input MAGs finished
[2022-07-04 09:43:52] Rd1: removing 16S sequences at the end of MAG contigs
[2022-07-04 09:43:53] Rd1: remove 16S sequences at the end of MAG contigs finished
[2022-07-04 09:43:53] Rd1: quality control provided 16S rRNA gene sequences to:
[2022-07-04 09:43:53] Rd1: remove non-16S sequences (if any)
[2022-07-04 09:43:53] Rd1: cluster at 99% identity and keep only the longest one in each cluster
[2022-07-04 09:43:57] Rd1: qualified 16S rRNA gene sequences exported to: reconstructed_16_polished_min1200bp_c99.fa
[2022-07-04 09:44:05] Rd1: mapping input reads to marker genes with 8 cores (be patient!)
[2022-07-04 09:44:28] Rd1: sorting test_input_reads_to_16S.sam
[bam_sort_core] merging from 0 files and 8 in-memory blocks...
[2022-07-04 09:44:32] Rd1: calculating the number of lines per subset
[2022-07-04 09:44:33] Rd1: splitting sam file
[2022-07-04 09:44:35] Rd1: analysing mappping results with 8 threads
[2022-07-04 09:44:37] Rd1: removing splitted subsets from disk
[2022-07-04 09:44:37] Rd1: reading filtered alignments into dict
[2022-07-04 09:44:38] Rd1: extracting sequences of reads matched to 16S
[2022-07-04 09:44:41] Rd1: mapping extracted reads to input genomes
[2022-07-04 09:45:05] Rd1: analysing mappping results
[2022-07-04 09:45:05] Rd1: processed 0.07k
[2022-07-04 09:45:05] Rd1: parsing MappingRecord dict to get linkages
[2022-07-04 09:45:05] Rd1: calculating pairwise 16S rRNA gene identities
[2022-07-04 09:45:11] Rd1: filtering linkages iteratively
[2022-07-04 09:45:11] Rd1: extracting linking reads for visualization
[2022-07-04 09:45:13] Rd1: visualizing 0 rd1 linkages with 8 threads
[2022-07-04 09:45:13] Rd2: get unlinked marker genes and genomes
[2022-07-04 09:45:13] Rd2: mapping input reads to the ends of contigs from unlinked genomes
[2022-07-04 09:45:59] Rd2: sorting mappping results
[bam_sort_core] merging from 0 files and 8 in-memory blocks...
[2022-07-04 09:46:01] Rd2: calculating the number of lines per subset
[2022-07-04 09:46:02] Rd2: splitting sam file
[2022-07-04 09:46:04] Rd2: reading in mappping results with 8 threads
[2022-07-04 09:46:06] Rd2: removing splitted subsets from disk
[2022-07-04 09:46:10] Rd2: running SPAdes on extracted reads
[2022-07-04 09:46:17] Mini-assembly not found! will report 1st round linkages only!
[2022-07-04 09:46:17] Visualising linkages
[2022-07-04 09:46:18] Linking MAGs to 16S rRNA genes done!
[2022-07-04 09:46:18] Command for 16S copy number calculation exported to log file
[2022-07-04 09:46:18] Get_cn: running V-Xtractor on 16S rRNA genes

V-Xtractor v. 2.1. Copyright (c) Hartmann et al. 2010.

09:46:25 [====                          ] 16.3% 09:47:20  Remaining: 0:00:46In sequence crc01+ETHSEQ0000005220+31, region V9 starts at 1390 and ends at 1236, which is backwards.
09:46:25 [=====                         ] 19.8% 09:47:20  Remaining: 0:00:44In sequence crc01+ETHSEQ0000005220+9, region V9 starts at 1384 and ends at 87, which is backwards.
09:46:25 [======                        ] 22.1% 09:47:19  Remaining: 0:00:42In sequence crc01+ETHSEQ0000005220+42, region V9 starts at 1384 and ends at 721, which is backwards.
09:46:25 [==========                    ] 34.3% 09:47:23  Remaining: 0:00:38In sequence crc01+ETHSEQ0000005220+65, region V9 starts at 1272 and ends at 1059, which is backwards.
09:46:25 [======================        ] 75.7% 09:47:21  Remaining: 0:00:13In sequence crc01+ETHSEQ0000005220+72, region V9 starts at 1395 and ends at 442, which is backwards.
09:46:25 [==============================]  100% 09:47:21      Total: 0:00:56

[2022-07-04 09:47:22] Get_cn: subsampling reads for MAG coverage estimation
[2022-07-04 09:47:28] Get_cn: mapping reads to combined prefixed MAGs
Error: reads file does not look like a FASTA file
terminate called after throwing an instance of 'int'
(ERR): bowtie2-align died with signal 6 (ABRT) (core dumped)
[2022-07-04 09:47:42] Get_cn: removing high mismatch alignments
[2022-07-04 09:47:43] Get_cn: removing singletons
[2022-07-04 09:47:43] Get_cn: sorting filtered sam file
[2022-07-04 09:47:43] Get_cn: getting depth with samtools
[2022-07-04 09:47:43] Get_cn: reading in MAG sequences
[2022-07-04 09:47:43] Get_cn: reading in Barrnap outputs
[2022-07-04 09:47:43] Get_cn: reading in depth file
[2022-07-04 09:47:43] Get_cn: getting Coverage and GC bias for 0 Genomes with 8 cores
[2022-07-04 09:47:43] Get_cn: get Coverage and GC bias done
cat: output_test/test_get_16S_cp_num_wd/test_MAG_depth_GC_content/*.txt: No such file or directory
[2022-07-04 09:47:43] Get_cn: splitting sorted sam file 
[2022-07-04 09:47:46] Get_cn: parsing alignments of reads to all 16S with multiple threads
[2022-07-04 09:47:48] Get_cn: parsing alignments of reads to linked 16S with multiple threads
[2022-07-04 09:47:48] Get_cn: filtering sam file for all 16S
[2022-07-04 09:47:51] Get_cn: filtering sam file for linked 16S
[2022-07-04 09:47:52] Get_cn: sorting filtered sam file by contig id
[bam_sort_core] merging from 0 files and 8 in-memory blocks...
[2022-07-04 09:47:52] Get_cn: getting depth directly from sam file (all 16S)
[2022-07-04 09:47:52] Get_cn: getting depth directly from sam file (linked 16S)
[2022-07-04 09:47:52] Get_cn: estimated copy number exported to test_copy_num_by_MAG.txt
[2022-07-04 09:47:52] Get_cn: removing tmp files
[2022-07-04 09:47:52] Get_cn: Done!
[2022-07-04 09:47:52] Estimated copy number 16S rRNA genes exported to:
[2022-07-04 09:47:52] output_test/test_copy_num_by_16S.txt
[2022-07-04 09:47:52] output_test/test_copy_num_by_MAG.txt
[2022-07-04 09:47:52] All done!
[2022-07-04 09:47:52] In summary:
1. Quality filtered 16S exported to: reconstructed_16_polished_min1200bp_c99.fa
2. Identified linkages exported to: test_linkages_by_contig/genome.txt
3. Linking profiles exported to: test_linkage_visualization_rd1/2
4. Estimated copy number exported to: test_copy_num_by_16S/MAG.txt

Unfortunately most of the results seems to be empty. These files have only the header: test_copy_num_by_16S.txt, test_copy_num_by_MAG.txt, test_linkages_by_contig.txt, test_linkages_by_genome.txt.

AlessioMilanese commented 2 years ago

I see:

Error: reads file does not look like a FASTA file
terminate called after throwing an instance of 'int'
(ERR): bowtie2-align died with signal 6 (ABRT) (core dumped)

If I try to transform the input to fasta, seems there is no more error:

[2022-07-04 10:23:22] parameters for linking
 + mismatch:    2%
 + min_M_len:   45bp
 + min_M_pct:   35%
 + min_link_num_gnm:    9
 + min_link_num_ctg:    3
 + rd2_end_seq_len: 1000bp
 + max_short_cigar_pct: 75,85
[2022-07-04 10:23:22] parameters for estimating copy number
 + MAG_cov_subsample_pct:   25%
 + min_insert_size_16s: -1000bp
 + ignore_ends_len_16s: 150bp
 + ignore_lowest_pct:   25%
 + ignore_highest_pct:  25%
 + both_pair_mapped:    False
[2022-07-04 10:23:22] Rd1: identifying 16S rRNA genes in input MAGs with barrnap
[2022-07-04 10:23:30] Rd1: identify 16S rRNA genes in input MAGs finished
[2022-07-04 10:23:30] Rd1: removing 16S sequences at the end of MAG contigs
[2022-07-04 10:23:30] Rd1: remove 16S sequences at the end of MAG contigs finished
[2022-07-04 10:23:30] Rd1: quality control provided 16S rRNA gene sequences to:
[2022-07-04 10:23:30] Rd1: remove non-16S sequences (if any)
[2022-07-04 10:23:30] Rd1: cluster at 99% identity and keep only the longest one in each cluster
[2022-07-04 10:23:35] Rd1: qualified 16S rRNA gene sequences exported to: reconstructed_16_polished_min1200bp_c99.fa
[2022-07-04 10:23:37] Rd1: mapping input reads to marker genes with 8 cores (be patient!)
[2022-07-04 10:24:00] Rd1: sorting test_input_reads_to_16S.sam
[bam_sort_core] merging from 0 files and 8 in-memory blocks...
[2022-07-04 10:24:02] Rd1: calculating the number of lines per subset
[2022-07-04 10:24:02] Rd1: splitting sam file
[2022-07-04 10:24:04] Rd1: analysing mappping results with 8 threads
[2022-07-04 10:24:06] Rd1: removing splitted subsets from disk
[2022-07-04 10:24:06] Rd1: reading filtered alignments into dict
[2022-07-04 10:24:07] Rd1: extracting sequences of reads matched to 16S
[2022-07-04 10:24:09] Rd1: mapping extracted reads to input genomes
[2022-07-04 10:24:35] Rd1: analysing mappping results
[2022-07-04 10:24:35] Rd1: processed 0.07k
[2022-07-04 10:24:35] Rd1: parsing MappingRecord dict to get linkages
[2022-07-04 10:24:35] Rd1: calculating pairwise 16S rRNA gene identities
[2022-07-04 10:24:37] Rd1: filtering linkages iteratively
[2022-07-04 10:24:37] Rd1: extracting linking reads for visualization
[2022-07-04 10:24:39] Rd1: visualizing 0 rd1 linkages with 8 threads
[2022-07-04 10:24:40] Rd2: get unlinked marker genes and genomes
[2022-07-04 10:24:40] Rd2: mapping input reads to the ends of contigs from unlinked genomes
[2022-07-04 10:25:23] Rd2: sorting mappping results
[bam_sort_core] merging from 0 files and 8 in-memory blocks...
[2022-07-04 10:25:26] Rd2: calculating the number of lines per subset
[2022-07-04 10:25:26] Rd2: splitting sam file
[2022-07-04 10:25:28] Rd2: reading in mappping results with 8 threads
[2022-07-04 10:25:30] Rd2: removing splitted subsets from disk
[2022-07-04 10:25:34] Rd2: running SPAdes on extracted reads
[2022-07-04 10:25:46] Mini-assembly not found! will report 1st round linkages only!
[2022-07-04 10:25:46] Visualising linkages
[2022-07-04 10:25:47] Linking MAGs to 16S rRNA genes done!
[2022-07-04 10:25:47] Command for 16S copy number calculation exported to log file
[2022-07-04 10:25:47] Get_cn: running V-Xtractor on 16S rRNA genes

V-Xtractor v. 2.1. Copyright (c) Hartmann et al. 2010.

10:25:53 [=====                         ] 17.4% 10:26:50  Remaining: 0:00:47In sequence crc01+ETHSEQ0000005220+31, region V9 starts at 1390 and ends at 1236, which is backwards.
10:25:53 [=====                         ] 18.6% 10:26:51  Remaining: 0:00:47In sequence crc01+ETHSEQ0000005220+9, region V9 starts at 1384 and ends at 87, which is backwards.
10:25:53 [======                        ] 22.1% 10:26:51  Remaining: 0:00:45In sequence crc01+ETHSEQ0000005220+42, region V9 starts at 1384 and ends at 721, which is backwards.
10:25:53 [==========                    ] 34.3% 10:26:51  Remaining: 0:00:38In sequence crc01+ETHSEQ0000005220+65, region V9 starts at 1272 and ends at 1059, which is backwards.
10:25:53 [======================        ] 75.7% 10:26:49  Remaining: 0:00:13In sequence crc01+ETHSEQ0000005220+72, region V9 starts at 1395 and ends at 442, which is backwards.
10:25:53 [==============================]  100% 10:26:49      Total: 0:00:56

[2022-07-04 10:26:50] Get_cn: subsampling reads for MAG coverage estimation
[2022-07-04 10:26:54] Get_cn: mapping reads to combined prefixed MAGs
[2022-07-04 10:27:22] Get_cn: removing high mismatch alignments
[2022-07-04 10:27:26] Get_cn: removing singletons
[2022-07-04 10:27:31] Get_cn: sorting filtered sam file
[bam_sort_core] merging from 0 files and 8 in-memory blocks...
[2022-07-04 10:27:36] Get_cn: getting depth with samtools
[2022-07-04 10:27:46] Get_cn: reading in MAG sequences
[2022-07-04 10:27:46] Get_cn: reading in Barrnap outputs
[2022-07-04 10:27:46] Get_cn: reading in depth file
[2022-07-04 10:28:14] Get_cn: getting Coverage and GC bias for 0 Genomes with 8 cores
[2022-07-04 10:28:15] Get_cn: get Coverage and GC bias done
cat: output_test_fasta/test_get_16S_cp_num_wd/test_MAG_depth_GC_content/*.txt: No such file or directory
[2022-07-04 10:28:15] Get_cn: splitting sorted sam file 
[2022-07-04 10:28:18] Get_cn: parsing alignments of reads to all 16S with multiple threads
[2022-07-04 10:28:21] Get_cn: parsing alignments of reads to linked 16S with multiple threads
[2022-07-04 10:28:22] Get_cn: filtering sam file for all 16S
[2022-07-04 10:28:24] Get_cn: filtering sam file for linked 16S
[2022-07-04 10:28:25] Get_cn: sorting filtered sam file by contig id
[bam_sort_core] merging from 0 files and 8 in-memory blocks...
[2022-07-04 10:28:25] Get_cn: getting depth directly from sam file (all 16S)
[2022-07-04 10:28:25] Get_cn: getting depth directly from sam file (linked 16S)
[2022-07-04 10:28:25] Get_cn: estimated copy number exported to test_copy_num_by_MAG.txt
[2022-07-04 10:28:25] Get_cn: removing tmp files
[2022-07-04 10:28:25] Get_cn: Done!
[2022-07-04 10:28:27] Estimated copy number 16S rRNA genes exported to:
[2022-07-04 10:28:27] output_test_fasta/test_copy_num_by_16S.txt
[2022-07-04 10:28:27] output_test_fasta/test_copy_num_by_MAG.txt
[2022-07-04 10:28:27] All done!
[2022-07-04 10:28:27] In summary:
1. Quality filtered 16S exported to: reconstructed_16_polished_min1200bp_c99.fa
2. Identified linkages exported to: test_linkages_by_contig/genome.txt
3. Linking profiles exported to: test_linkage_visualization_rd1/2
4. Estimated copy number exported to: test_copy_num_by_16S/MAG.txt

But the result files are still empty.

The input fasta looks like:

$ head test_R1.fasta 
>test_1.1
GATCTCTTTCCACATCTACAATGCAGGTTATGTTGAAGTTGGAAACATTTTCTTTCATCATAGGTAAGAGTTCCTGCGGAAAATAGAAA
>test_2.1
CAATAAGGCTCAGCGGAATACACATCATCACCATGATGGACAGCCGGGGGG
>test_3.1
AAGATGTAATACTCATAAGGGACTTCCTCGGTGGTGGTTTCCCCGGTTTCCGGGTCGGTACTTGTTTCGGTGCGGT
>test_4.1
CCGCAAAGGTCAACGGAACGGTAACGGAAATCGCACGAGATAAGACAAAAACAAAGTCGAGCTGTCGGACACTTCCCCTAATCCCTGCCTGTGAG
>test_5.1
ATCGAGCTAATCCAACCAGCAAGTGCTTGACCAGACATCCCGATATTGAAGAGACCTACTTTCATTGCTACCGCAAAAGATAAAGC
songweizhi commented 2 years ago

The input fasta file looks all good. Do you have any idea on the coverage of the input MAGs? For a MAG to be linked to 16S rRNA gene, a sequencing depth of 20x is normally needed.

AlessioMilanese commented 2 years ago

I see, is there a way to lower this threshold? I will also check the average base coverage and try other samples!

Laura-Alex commented 2 years ago

Update:

With the new version (updated with conda*), things worked for me.

I've tried it on a varied group of metagenomic samples. Got nearly all of the bins matched with 16S in a low-diversity enriched culture. More limited for datasets with metagenomes with limited sequence data (few bins) and for some high-diversity metagenomes, but still, very impressive! Round 2 got a couple of additional results for the rare metagenome which was both high-depth and highly diverse. In terms of resources, I got most of the work done with 12 cores, 1GB each, except for a larger metagenome (~50Gbases) that required ~40-50 GB of memory in total.

Thank you for the useful software!

*For some reason, upgrading with conda automatically downgraded bowtie2 to a version that MarkerMag was no longer compatible with. I could upgrade bowtie2 again with conda and that worked, it was just unusual. Not sure if it's just my setup.

wanxn518 commented 11 months ago

Hi

I'm using the latest version, but I also have this problem, the bowtie2 version is not compatible and there are errors during the runtime.

Best, xnw