search

splatlab / squeakr

Squeakr: An Exact and Approximate k -mer Counting System
BSD 3-Clause "New" or "Revised" License
85 stars 23 forks source link

squeakr-query "Not Find: 0" #30

Closed nsohail19 closed 6 years ago

nsohail19 commented 6 years ago

Whenever I have tried to query for a specific sequence using squeakr-query, it returns with "Not find: 0". I have tried sequences that are from the fastq files as well as sequences that should not be found in the genome, but I get the same result each time.

In addition, when I try to use squeakr-query using a sequence from the exact branch, it gives me the following error: terminate called after throwing an instance of 'std::invalid_argument' what(): stoll Aborted

prashantpandey commented 6 years ago

Hi @nsohail19,

Could you please tell me the set of steps you executed, like squeakr-count and squeakr-query exact commands?

Thanks, Prashant

nsohail19 commented 6 years ago

My commands for squeakr-count were like this: ./squeakr-count -g -k 30 -s 30 -t 3 -o HGGs/squeakr_output/ HGGs/SRR7050122_1.fastq.gz

And for squeakr-query, like this: ./squeakr-query -f HGGs/squeakr_output/SRR7050122_1.fastq.gz.ser -k 30 -n 1 -r ACAATGGCCCAGTGGACAGCTGTGCACTCT

prashantpandey commented 6 years ago

Hi @nsohail19,

In the command for query, the -r is to specify if you want to query random k-mers or existing k-mers. 0 means query existing k-mers and 1 means query random k-mers.

So, based on the command you gave it seems the value of -r will be invalid.

Currently, the query command doesn't take as input a string. We will soon release a new API which will support specifing a query string.

Thanks, Prashant