migration needed!

[bradfordcondon]

need migration to convert old ssrs into new ones.

[bradfordcondon]

it would be a lot easier if we could just a) delete the old properties and b) reload the files. No downside I can see.

select distinct fp.value from chado.featureprop fp 
inner join chado.cvterm cvt ON fp.type_id = cvt.cvterm_id WHERE cvt.name IN
 ('tripal_ssr_forward_tm', 'tripal_ssr_reverse_tm', 'tripal_ssr_product_size',
 'tripal_ssr_reverse_primer', 'tripal_ssr_forward_primer',
 'tripal_ssr_repeats','tripal_ssr_motif');

gets all the featureprops.

This would be be imposible if we cant find hte files, but im pretty sure we actually host the files on HWG.

[bradfordcondon]

I made a full list her:

predicted

Black cherry (Prunus serotina) Black walnut (Juglans nigra) Blackgum (Nyssa sylvatica) Green ash (Fraxinus pennsylvanica) Honeylocust (Gleditsia triacanthos) Redbay (Persea borbonia) Sugar maple (Acer saccharinum) Sweetgum (Liquidambar styraciflua) White ash (Fraxinus americana) White oak (Quercus alba) these all belong to: Publication: Staton M, Best T, Khodwekar S, Owusu S, Xu T, Xu Y, Jennings T, Cronn R, Arumuganathan AK, Coggeshall M, Gailing O. Preliminary Genomic Characterization of Ten Hardwood Tree Species from Multiplexed Low Coverage Whole Genome Sequencing. PloS one. 2015 Dec 23;10(12):e0145031.

So those wll be a single analysis.

confirmed

P serotina L styraficlua F pennsylvanica F americana A saccharum additional pubs:

Noakes AG, Best T, Staton ME, Koch J, Romero-Severson J. Cross amplification of 15 EST-SSR markers in the genus Fraxinus. Conservation Genetics Resources. 2014 Dec 1;6(4):969-70.

Khodwekar S, Staton M, Coggeshall MV, Carlson JE, Gailing O. Nuclear microsatellite markers for population genetic studies in sugar maple (Acer saccharum Marsh.). Annals of Forest Research. 2015 Apr 15;58(2):193-204.

Can we find files for each of these?

[bradfordcondon]

https://www.hardwoodgenomics.org/organism/Prunus/serotina?tripal_pane=group_predicted_ssrs_genomic

confirmed:

Seq_name	Lab Specific Marker Name	Motif	Forward Primer	Reverse Primer	Predicted Amplicon Size	Amplification?	Size on gel	Likely to be polymorphic?
@HWI-ST609:156:C0NHEACXX:1:2310:15489:2132	2132	AT	ATTTAATGATGGAATCTTC	AGTTTCCGAGATATAAAAT	184	yes	170-200	yes

predicted : (di, tri, etc seperated)

Sequence Name	Motif	# Repeats	Start	End	Forward Primer	Reverse Primer	Forward Tm	Reverse Tm	Fragment Size
Contig_from_HWI-ST609:156:C0NHEACXX:1:1101:17002:1897	ct	9	65	82	CTATAGTCCGGTGGGCTATCG	ACCAAGATCTCAACTGCTAGCC	59.256	60.093	134

what isnt clear to me is how these are linked back to features.... worst case scenario its in the sript output but not in the excel file

[bradfordcondon]

delete the featureprops

delete FROM chado.featureprop fp
WHERE fp.type_id IN (SELECT cvterm_id FROM chado.cvterm cvt WHERE cvt.name IN 
('tripal_ssr_forward_tm', 'tripal_ssr_reverse_tm', 'tripal_ssr_product_size',
 'tripal_ssr_reverse_primer', 'tripal_ssr_forward_primer',
 'tripal_ssr_repeats','tripal_ssr_motif'));

load the files at /var/www/html/sites/default/files/ssr using a regexp for each.