Closed bradfordcondon closed 6 years ago
P serotina L styraficlua F pennsylvanica F americana A saccharum additional pubs:
Noakes AG, Best T, Staton ME, Koch J, Romero-Severson J. Cross amplification of 15 EST-SSR markers in the genus Fraxinus. Conservation Genetics Resources. 2014 Dec 1;6(4):969-70.
Khodwekar S, Staton M, Coggeshall MV, Carlson JE, Gailing O. Nuclear microsatellite markers for population genetic studies in sugar maple (Acer saccharum Marsh.). Annals of Forest Research. 2015 Apr 15;58(2):193-204.
Of the 96 tested SSRs, 48 successfully amplified and 26 were found to be polymorphic.
https://www.hardwoodgenomics.org/sites/default/files/gSSRs/CarlsonLab_BlackCherry_TestedSSRs.xlsx
Of the 96 tested SSRs, 44 successfully amplified and 28 were found to be polymorphic.
https://www.hardwoodgenomics.org/sites/default/files/gSSRs/CarlsonLab_Sweetgum_TestedSSRs.xlsx
Supplemental file is a pdf table with the following columns
EST-SSR marker (Fp12353), accession number (KJ626347), forward sequence, reverse sequence, size range, heterozygosity stats, and motif.
Noakes AG, Best T, Staton ME, Koch J, Romero-Severson J. Cross amplification of 15 EST-SSR markers in the genus Fraxinus. Conservation Genetics Resources. 2014 Dec 1;6(4):969-70.
A subset of the predicted SSRs have been screened for polymorphism and published in a population diversity study:
Khodwekar S, Staton M, Coggeshall MV, Carlson JE, Gailing O. Nuclear microsatellite markers for population genetic studies in sugar maple (Acer saccharum Marsh.). Annals of Forest Research. 2015 Apr 15;58(2):193-204.
select count(*) from chado.featureprop fp INNER JOIN chado.cvterm cvt ON cvt.cvterm_id = fp.type_id WHERE cvt.name ='tripal_ssr_forward_primer';
8566 on live, 8367 on dev.
Assuming that all SSRs loaded for all species (check) this means that htere ARE confirmed SSRs that were loaded on live that I just cant find the files and/or information for.
select o.common_name, count(f.feature_id) from chado.featureprop fp INNER JOIN chado.cvterm cvt ON cvt.cvterm_id = fp.type_id INNER JOIN chado.feature f ON f.feature_id = fp.feature_id INNER JOIN chado.organism o ON o.organism_id = f.organism_id WHERE cvt.name ='tripal_ssr_forward_primer' Group by o.common_name;
American Beech 28
American Chestnut 737
American Sweetgum 2070
Blackgum 844
Black Walnut 925
Green Ash 482
Honeylocust 327
Northern Red Oak 494
Red Alder 232
Sugar Maple 1477
Tulip Poplar 482
White Alder 188
White Oak 81
and on dev
American Beech 28
American Chestnut 773
American Sweetgum 2147
Blackgum 854
Black Walnut 939
Green Ash 484
Honeylocust 327
Northern Red Oak 497
Red Alder 239
Sugar Maple 1514
Tulip Poplar 489
White Alder 191
White Oak 84
using wc -l
black gum: 854 Black Walnut: 939 white alder : 191
So the DEV matches the actual files.
either the original pipeline made mistakes loading the files... or the list of features was ammended on live (ie some primers were removed...)
here's the carlson data for sweetgum
Seq_name | Lab Specific Marker Name | Motif | Forward Primer | Reverse Primer | Predicted Amplicon Size | Amplification? | Size on gel | Likely to be polymorphic? |
---|---|---|---|---|---|---|---|---|
HWI-ST609:156:C0NHEACXX:1:2209:7701:3126 | 3126 | AT | GGGGTAAAATAGAAAATTA | TCTAATGCGATTAAATCTA | 178 | NO | N/A | |
HWI-ST609:156:C0NHEACXX:1:1305:12569:4331 | 4331 | tc | CACTACTCTTTCTTTAACCAGACG | TCCTCTGTTCCTGTAATTGGC | 150 | YES | 150-200 | Yes |
HWI-ST609:156:C0NHEACXX:1:2309:21286:5769 | 5769 | ag | TTGCTCCAAGCTTTGTCTCC | CATCATCACAATCATTCTCCC | 199 | YES | 170-200 | Yes |
HWI-ST609:156:C0NHEACXX:1:1313:2176:5884 | 5884 | ct | CAATGCATAAGATACAACTCCC | ATGAGAGGAGGGAAAGGAGG | 197 | NO | N/A | |
HWI-ST609:156:C0NHEACXX:1:1208:13723:6315 | 6315 | ga | TGGTACTTGGTAGGTCTAG | CTCTCTTTTACAGAGTCGT | 155 | NO | N/A | |
HWI-ST609:156:C0NHEACXX:1:1311:9814:6626 | 6626 | ta | TTATTGCAACAATGCTTCCC | AGGTATACGTCACCATGAAACG | 196 | YES | 170-200 | |
HWI-ST609:156:C0NHEACXX:1:2306:2336:8086 | 8086 | AG | ATGATTTTAAATTACCCTC | TTTATTATTAGGTGCACAC | 130 | NO | N/A | |
HWI-ST609:156:C0NHEACXX:1:2103:5097:8342 | 8342 | ct | TCTTACCAGCTGCTGTTTGC | GGGATGTAGTAAGGCCCAGC | 171 | YES | 170-200 | Yes |
HWI-ST609:156:C0NHEACXX:1:1211:8437:8685 | 8685 | ct | TTTTCATAACAAGAAGTTG | AGTTGTTAGAGAATTGGAG | 155 | NO | N/A | |
HWI-ST609:156:C0NHEACXX:1:1211:21123:8752 | 8752 | AT | AGATGGGTCTAGAAAATTA | AAAGGCTGAAGTTAGTAAT | 155 | NO | N/A | |
HWI-ST609:156:C0NHEACXX:1:1113:3078:8808 | 8808 | at | GGAGATCCTTGGCTATGTGC | TAGCCACCCATTCATAACCG | 150 | YES | 150-200 | Yes |
HWI-ST609:156:C0NHEACXX:1:1308:14461:9551 | 9551 | ct | TGCAATAGCTGTCAATAACTCC | GAGCGAGCATGACATCACC | 150 | YES | 150-200 | |
HWI-ST609:156:C0NHEACXX:1:1206:11292:10654 | 10654 | ga | ATGGCTCAAGGGTTTCACG | GCATGCCCTAGTCAAAGTGG | 200 | NO | N/A | |
HWI-ST609:156:C0NHEACXX:1:2209:2517:11530 | 11530 | at | GCTTTGATGTATTTGTTGGG | GGGTGTGTGTCTCTTATCAAGC | 171 | NO | N/A |
our SSR file looks like this:
Liquidambar_styraciflua_01052015_comp49593_c4_seq13_ssr327 tc 9 327 345 GAAGTTGCCAAAGTCCACGC TCTCAACCTCACATGTCAGTCC 60.318 59.700 20
so no way that the scaffold names would line up.
Furthermore, the primers do not exist in the database/are not in the ssr input files. There is therefore no way to "reverse engineer" which SSR the confirmed ones belong to. At this point im pretty sure they are a totally different pool of primers. This means our module cannot load them.
so to summarize: there are no confirmed polymorphic files. They call SNPs from reads, and havent been trnaslated to features, and wont be. can close.