import error with "find_near_matches_with_ngrams"

[sasi143]

Here is my code taken from the readme file

`sequence = '''\ GACTAGCACTGTAGGGATAACAATTTCACACAGGTGGACAATTACATTGAAAATCACAGATTGGTCACACACACA TTGGACATACATAGAAACACACACACATACATTAGATACGAACATAGAAACACACATTAGACGCGTACATAGACA CAAACACATTGACAGGCAGTTCAGATGATGACGCCCGACTGATACTCGCGTAGTCGTGGGAGGCAAGGCACACAG GGGATAGG'''

subsequence = 'TGCACTGTAGGGATAACAAT' #distance 1 max_distance = 2

from fuzzysearch import find_near_matches_with_ngrams

print(find_near_matches_with_ngrams(subsequence, sequence, max_distance)) `

This output I am getting `--------------------------------------------------------------------------- ImportError Traceback (most recent call last)

in 8 max_distance = 2 9 ---> 10 from fuzzysearch import find_near_matches_with_ngrams 11 12 print(find_near_matches_with_ngrams(subsequence, sequence, max_distance)) ImportError: cannot import name 'find_near_matches_with_ngrams' from 'fuzzysearch' (c:\users\ssadam\appdata\local\continuum\anaconda3\envs\ner\lib\site-packages\fuzzysearch\__init__.py)`

[sasi143]

@taleinat , I know maybe I am following older docs, but I didn't get any other new docs to use find_near_matches_with_ngrams functionality

[sasi143]

@taleinat , I had seen a lot of functionalities are in source code and it would be great if you update the readme file or docs with the new content.

Respect your work and time

[taleinat]

@sasi143, thanks for reporting this!

That example is no longer in the readme, but it is in the "usage" page in the docs, and should definitely be fixed!

[taleinat]

@sasi143, I've fixed the usage example on the Usage page of the documentation.

I've also added quite a bit of detail there about the available internal functions and how to use them.