STAR exiting with short read sequence error

[GoogleCodeExporter]

What steps will reproduce the problem?
1. Use the following as input.
$ cat offending_R1.fa
>HS13_186:2:2106:7552:5018/1
TTGTTTTTTGTGTCTCAAATTAACAACCTAACATCATAACTGAAAGAATAAGTGAAGCAAGAACAAATCAAC
$ cat offending_R2.fa
>HS13_186:2:2106:7552:5018/2
TTGTTTTTTGTGTCTCAATTTCCTTCGATTCAGCTCTGATTTTGGTTATTTCTTATCTTCTGCTAGCTTTGG
2. Run STAR like this:
STAR_2.3.1z1/STAR --genomeDir /raid/references-and-indexes/hg19/star/2013_03_04 
--genomeLoad NoSharedMemory --readFilesIn
 offending_R1.fa offending_R2.fa --outStd SAM > test.sam

What is the expected output? What do you see instead?
STAR quits with the following error:

EXITING because of FATAL ERROR in reads input: short read sequence line: 1
Read Name=>HS13_186:2:2106:7552:5018/2
Read Sequence====
DEF_readNameLengthMax=50000
DEF_readSeqLengthMax=50000

What version of the product are you using? On what operating system?
STAR_2.3.1z1
$ cat /etc/SuSE-release
openSUSE 12.3 (x86_64)
VERSION = 12.3
CODENAME = Dartmouth

Please provide any additional information below.
I was having a problem with this input using STAR version STAR_2.3.0e although 
I think the error was different. I upgraded to see if the problem was fixed but 
it does not seem to be.

-Chris DeBoever

Original issue reported on code.google.com by cdeboev...@gmail.com on 14 Apr 2014 at 8:51

[GoogleCodeExporter]

For a faster response, please post your questions in the STAR forum 
https://groups.google.com/d/forum/rna-star, or e-mail me directly at 
dobin@cshl.edu

I believe this is caused by the lack of new-line character after the last line 
(i.e. before the end of the line). Try to add an empty extra line at the end of 
your file. I will fix this in the future releases.

Original comment by adobin@gmail.com on 16 Apr 2014 at 8:15