search

torognes / swarm

A robust and fast clustering method for amplicon-based studies
GNU Affero General Public License v3.0
123 stars 23 forks source link

abundance values generator? #131

Closed dcm9123 closed 5 years ago

dcm9123 commented 5 years ago

Hi! I was just wondering if the --derep_fulllength with the option of --sizeoutgenerates the appropriate abundance values required by swarm?

One of my output sequences from this generator is the following:

>797d2f73bb1f3a506c560c8ad547cb7cbf74a8a7;size=36
GTATTGACAGGTTATAGTTTATTTCAAAAGGAAAAAATGGTATTAAATGAAGGAACAAGTGGAACAGCTGTTACAACTAGTACACCTGGTTCAAAGGGTTCAGTTACTTCAGGTGGTTCAGGTGGTTCAGGTGGTTCAGGTGCTACAGTACCTTCA

Does this mean that if I replace the ';' that separates the header from the size with a '_', it will serve as the required abundance values for swarm?

Thanks!

frederic-mahe commented 5 years ago

@dcastaneda5 you can use swarm with the -z option to accept ;size=INTEGER as abundance values.

dcm9123 commented 5 years ago

That worked! Thanks a lot!