file is not a readable non-empty FASTA file (OS: Linux mint, not WSL)

[Silverfoxcome]

Hi! Thanks a lot for making this useful tool!!!

It usually works perfectly but I'm having problems annotating a few genomes I downloaded from the PATRIC database.

This is my file:

head 210.1380.fna

>CP010013   Helicobacter pylori strain Hp238, complete genome.   [Helicobacter pylori Hp238 | 210.1380]
ACGACTTTTCGTGCTCCATCGCTGTTTTTCTAAAGTGGTTACTGATTTTAATATCATTTG
TCTAAAACTATACTTAATATTCTAAAAAGGCTTAAACTCAAACCCCCAACGCTCTTAAGC
TCTATAGATTCCATGCTTTAAAGCTTCAATTCTTTGATTATTGCCTAAATCATGTTCTCT
TTTTAATTTTTCACAACCATTAAATATAAAACACCCTCAATTCAAGGGTTTTTGAGTGAG
....

I ran the command: prokka --outdir Hp238 --prefix Hp238 ../210.1380.fna

But prokka gives me this message:

[12:15:08] This is prokka 1.14.5
[12:15:08] Written by Torsten Seemann <torsten.seemann@gmail.com>
[12:15:08] Homepage is https://github.com/tseemann/prokka
[12:15:08] Local time is Sat Aug 13 12:15:08 2022
[12:15:08] You are koala
[12:15:08] Operating system is linux
[12:15:08] You have BioPerl 1.007002
[12:15:08] System has 4 cores.
[12:15:08] Option --cpu asked for 8 cores, but system only has 4
[12:15:08] Will use maximum of 4 cores.
[12:15:08] Annotating as >>> Bacteria <<<
[12:15:08] '210.1380.fna' is not a readable non-empty FASTA file

My file is not an empty fasta file so I looked at the permissions:

I installed prokka via anaconda: which prokka /home/koala/anaconda3/envs/prokka/bin/prokka

prokka --version prokka 1.14.5

The same happens with the prokka I installed via singularity.

I would be very grateful for any help you can give me.

Thanks a lot in advance :)

[mmpust]

did you solve it? I am having the same problem.