search

ucscGenomeBrowser / kent

UCSC Genome Browser source tree. Stable branch: "beta".
http://genome.ucsc.edu/
Other
219 stars 89 forks source link

Blat not finding Sequence #60

Closed smoijueh closed 3 years ago

smoijueh commented 3 years ago

The command line version of blat is not finding a sequence in the human genome. I'm able to locate that same sequence on the UCSC Genome Browser version of blat.

I downloaded the Linux command line version of Blat (blat - Standalone BLAT v. 37x1 fast sequence search command line tool) and hg38.2bit from https://hgdownload.cse.ucsc.edu/goldenpath/hg38/bigZips/hg38.2bit.

The specific sequence I want to query is

>query1 GGTTTCGCAGATTTTTCCCGACTCTGTAATGTTGGCGGTGCAGGAAGGGATTGACTTACTCACTTTTCCGCCGGCGCCCGGTTCTCCGGAGCCGCCTCACCTTTCCCGGCAGCCCGAGCAGCCGGAGCAGAGAGCCTTGGGTCCGGTTTCTATGCCAAACCTTGTACCGGAGGTGATCGATCTTACCTGCCACGAGGCTTCCACCCAGTGACGACGAGGATGAAGAGGGTGAGGAGTTTGTGTTAGATTATGTGGAGCACCCCGGGCACGGTTGCAGGTCTTGTCATTATCACCGGAGGAATACGGGGGACCCAGATATTATGTGTTCGCTTTGCTATATGAGGACCTGTGGCATGTTTGTCTACA

Here's the blat command I'm using: ./blat -noHead -out=psl ~/Downloads/hg38.2bit query.fa output.psl

The command runs but nothing gets output to the output.psl file. The command works with other human genome sequences.

Here are the results from the BLAT UCSC genome browser: image

It finds the sequence on the browser tool but not the command line version. I've tried hg38.2bit, hg19.2bit, and the whole genome fasta files for hg19 and hg38. Any suggestions on why the command line tool isn't finding this sequence?

galt commented 3 years ago

Please send your question to genome@soe.ucsc.edu mailing list. They have support for UCSC Genome Browser including BLAT questions.