search

ui-icts / aptamer-web

MIT License
0 stars 0 forks source link

PredictStructures "--pass options" #3

Closed thielwh closed 5 years ago

thielwh commented 5 years ago

When using predict structures, how does the “--pass options” work? The script fails whenever I use pass-through options (e.g. -T 37)

chrisortman commented 5 years ago

@thielwh I tried running the script manually with pass options

➜  python predict_structures.py -v 2 --pass_options "-T 37" ./Final_Rd12.fa
##################
Running RNAFold...
##################
Command: RNAfold  -T 37
['AAACAUGCAUCAUCAGGUAAGUACGGUCCC', '..((.(((........))).))........ ( -0.90)', '']

Error parsing RNAfold output. (Couldn't find statistics.) Please check RNAfold options.

And it generated an error. I can dig it, but sharing it in case the error message tells you more than it tells me

thielwh commented 5 years ago

This might refer to the program trying to generate summary statistics for different structural properties. Either parsing the structure statistics of each sequence into a comma delimited file or calculating a mean and SEM of all the structures.

chrisortman commented 5 years ago

This is should be working on the aws box now. If you don't specify -p to RNAFold then it won't calculate statistics, so I add it if it isn't present.