And it trimmed more than half of my reads:
Using Long Clipping Sequence: 'TTCGTCACCATAGTTGCGTCTCATG'
ILLUMINACLIP: Using 0 prefix pairs, 3 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Input Reads: 4826329 Surviving: 2282550 (47.29%) Dropped: 2543779 (52.71%)
TrimmomaticSE: Completed successfully
Could someone explain what should I fix in the command?
Hello, I am trying to trim adapters of my PacBio data with trimmomatic. This is my command:
module load miniconda/miniconda3-4.7.12 module load idba
java -jar /dorotheeh/trimmomatic/trimmomatic-0.39.jar SE -phred33 PBrnaQ20.ccs.fastq.gz PBrnatrimmed.fq.gz ILLUMINACLIP:pacbio_vectors_db.fasta:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:400
And it trimmed more than half of my reads: Using Long Clipping Sequence: 'TTCGTCACCATAGTTGCGTCTCATG' ILLUMINACLIP: Using 0 prefix pairs, 3 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences Input Reads: 4826329 Surviving: 2282550 (47.29%) Dropped: 2543779 (52.71%) TrimmomaticSE: Completed successfully
Could someone explain what should I fix in the command?
Thank you!