search

vastgroup / vast-tools

A toolset for profiling alternative splicing events in RNA-Seq data.
MIT License
77 stars 29 forks source link

issue with 'align' #100

Closed yongshes closed 2 years ago

yongshes commented 3 years ago

Hi,

I tried to align sequences and got the following error message. I'd appreciate your help.

[vast align]: Input RNA-seq file(s): READ1.fa.gz Use of uninitialized value $length in concatenation (.) or string at /home/Scripts/vast-tools/bin/RunDBS_1.pl line 489. Use of uninitialized value $percF in concatenation (.) or string at /home/Scripts/vast-tools/bin/RunDBS_1.pl line 489. [vast align]: Most common read length detected for fq1: (%) [vast align]: Sample name: READ1 [vast align]: Using VASTDB -> /home/vast-tools/VASTDB/Hsa [vast align]: Setting output directory to /home/FASTQ/vast_out [vast align]: Setting tmp directory.. [vast align]: Set tmp directory to /home/FASTQ/vast_out/tmp! Use of uninitialized value $length in subtraction (-) at /home/Scripts/vast-tools/bin/RunDBS_1.pl line 522. Use of uninitialized value $length in concatenation (.) or string at /home/Scripts/vast-tools/bin/RunDBS_1.pl line 523. [vast align error]: Trim5 (0) cannot be applied for reads of length

Use of uninitialized value $length in numeric ge (>=) at /home/Scripts/vast-tools/bin/RunDBS_1.pl line 531. [vast align error]: Minimum reads length has to be 50nt

mirimia commented 3 years ago

Hello,

It's strange; it's not detecting the reads at all. Can you please paste the first few reads of your file? (I'm assuming they are >= 50 in FASTA format?)

Thanks Manu

yongshes commented 3 years ago

Hi Manu,

Thanks for you quick reply. Here is a couple of reads from the fastq file that I am using:

@K00339:125:HWJH7BBXX:1:1101:1529:1578 1:N:0:ATCACG GGGCGATGCGGCGCGCCTTGGCTTGCCGGGCCTTACGTCTGCGGATCTTACGGGCCGGCTGGTTGAACCACGTGGCCACGCGCCGCTGCCAGTCCTTGTG + AAFFFFJJJJJJJAJJFJJJJJJJJJJJJFJJJJJJJJJJJJJJF7F7<JJJFJJJJAFJJJJJFJJJJJJJ<JF<AFJJJJJJJJJJJJJJJJJJJJJJ @K00339:125:HWJH7BBXX:1:1101:2301:1578 1:N:0:ATCACG CCCCACAGCAGCCCCTGGAGGTTGTGGTAGGCGGAAAATGCAGAAACTTCTCTCAAAAGCGTCCATGTGGCTCTGTTGGGCCAGGCGGGTAGGGGACTCA + AAFFFJJJJJJJJJFJJJJJJAFJJJJJJJJJJJJJJJJJJJJJJJF<JJ<AAJJJJJJJJ<<AFJJ<FJJFF-FAAAFJFJJJFAJJAAJJJJJJJFJJ

It doesn’t have the length information in it. Do you know of any tools that can convert my file to the required format?

Thanks.

On Sep 1, 2021, at 12:47 AM, Manuel Irimia @.***> wrote:

Hello,

It's strange; it's not detecting the reads at all. Can you please paste the first few reads of your file? (I'm assuming they are >= 50 in FASTA format?)

Thanks Manu

— You are receiving this because you authored the thread. Reply to this email directly, view it on GitHub https://github.com/vastgroup/vast-tools/issues/100#issuecomment-910028912, or unsubscribe https://github.com/notifications/unsubscribe-auth/ALIBGF2TBVZP4K7M3EXAEJLT7XLBFANCNFSM5DFVQQHA. Triage notifications on the go with GitHub Mobile for iOS https://apps.apple.com/app/apple-store/id1477376905?ct=notification-email&mt=8&pt=524675 or Android https://play.google.com/store/apps/details?id=com.github.android&referrer=utm_campaign%3Dnotification-email%26utm_medium%3Demail%26utm_source%3Dgithub.

mirimia commented 3 years ago

OK. I think this is because you're using FASTQ files but your file extension is .fa.gz (for FASTA). If you rename them to .fq.gz or .fastq.gz it should work.

M

yongshes commented 3 years ago

Thanks, that solved the problem!

But now I get a new error:

gzip: stdout: Disk quota exceeded gzip: write error: Disk quota exceeded

There is plenty of disk space on my server. Sorry for bothering you with these small things, but I’d really appreciate your advice.

Thanks again!

On Sep 1, 2021, at 7:35 AM, Manuel Irimia @.***> wrote:

OK. I think this is because you're using FASTQ files but your file extension is .fa.gz (for FASTA). If you rename them to .fq.gz or .fastq.gz it should work.

M

— You are receiving this because you authored the thread. Reply to this email directly, view it on GitHub https://github.com/vastgroup/vast-tools/issues/100#issuecomment-910346897, or unsubscribe https://github.com/notifications/unsubscribe-auth/ALIBGF3EUZFVF2YTOLX3G4DT7Y2ZPANCNFSM5DFVQQHA. Triage notifications on the go with GitHub Mobile for iOS https://apps.apple.com/app/apple-store/id1477376905?ct=notification-email&mt=8&pt=524675 or Android https://play.google.com/store/apps/details?id=com.github.android&referrer=utm_campaign%3Dnotification-email%26utm_medium%3Demail%26utm_source%3Dgithub.

yongshes commented 3 years ago

By the way, there was one warning message when I ran ./install.R:

Using R version 4.0.4 (2021-02-15) Looking for VAST Database [VASTDB] Found 'VASTDB'.. Do you want to download yet uninstalled datasets or update installed datasets? [y/n]: n Trying to load required package: MASS Trying to load required package: getopt Trying to load required package: optparse Trying to load required package: RColorBrewer Trying to load required package: reshape2 Trying to load required package: ggplot2 Trying to load required package: grid Trying to load required package: parallel Trying to load required package: devtools Warning message: In for (i in seq_along(cenv$extra)) { : closing unused connection 3 (stdin) Loading required package: psiplot Setting vast-tools permissions... success! /dfs4/som/yongshes/Scripts/bowtie-1.0.0/bowtie Found bowtie... Everything looks --OK

I am not sure if this warning message is normal. Thanks.

On Sep 1, 2021, at 10:56 AM, Yongsheng Shi @.***> wrote:

Thanks, that solved the problem!

But now I get a new error:

gzip: stdout: Disk quota exceeded gzip: write error: Disk quota exceeded

There is plenty of disk space on my server. Sorry for bothering you with these small things, but I’d really appreciate your advice.

Thanks again!

On Sep 1, 2021, at 7:35 AM, Manuel Irimia @. @.>> wrote:

OK. I think this is because you're using FASTQ files but your file extension is .fa.gz (for FASTA). If you rename them to .fq.gz or .fastq.gz it should work.

M

— You are receiving this because you authored the thread. Reply to this email directly, view it on GitHub https://github.com/vastgroup/vast-tools/issues/100#issuecomment-910346897, or unsubscribe https://github.com/notifications/unsubscribe-auth/ALIBGF3EUZFVF2YTOLX3G4DT7Y2ZPANCNFSM5DFVQQHA. Triage notifications on the go with GitHub Mobile for iOS https://apps.apple.com/app/apple-store/id1477376905?ct=notification-email&mt=8&pt=524675 or Android https://play.google.com/store/apps/details?id=com.github.android&referrer=utm_campaign%3Dnotification-email%26utm_medium%3Demail%26utm_source%3Dgithub.

mirimia commented 3 years ago

Good.

Re the new errors, I doubt they are related to vast-tools (?). Ie. It seems a gzip issue somehow, so I have no clue why it could be...

Re the installation warning, we are changing that script, so perhaps is not working well. In any case, this is just to install R libraries and R is not used in align.

yongshes commented 3 years ago

OK, thanks again for all your help!

On Sep 1, 2021, at 11:12 AM, Manuel Irimia @.***> wrote:

Good.

Re the new errors, I doubt they are related to vast-tools (?). Ie. It seems a gzip issue somehow, so I have no clue why it could be...

Re the installation warning, we are changing that script, so perhaps is not working well. In any case, this is just to install R libraries and R is not used in align.

— You are receiving this because you authored the thread. Reply to this email directly, view it on GitHub https://github.com/vastgroup/vast-tools/issues/100#issuecomment-910533604, or unsubscribe https://github.com/notifications/unsubscribe-auth/ALIBGF3A45HB24332FGBDKDT7ZUJRANCNFSM5DFVQQHA. Triage notifications on the go with GitHub Mobile for iOS https://apps.apple.com/app/apple-store/id1477376905?ct=notification-email&mt=8&pt=524675 or Android https://play.google.com/store/apps/details?id=com.github.android&referrer=utm_campaign%3Dnotification-email%26utm_medium%3Demail%26utm_source%3Dgithub.