Closed mirimia closed 10 years ago
Hi Manuel,
Are you forgetting the undocumented options I created for you for this purpose... --preTrimmed
and --useFastq
I recall...?
-T
Hi Tim,
But I'm running align as default (that is, no --preTrimmed). Use --useFastq may solve it, but before it wasn't necessary to start with regular raw (fastq) reads, right?
Thanks, M
Ohh.. I see now... Yes you're right, whoops.. I did mess it up! Sorry bout that!
No problem! Thanks!
Hi Tim,
I think the change to allow vast-tools to run with pretrimmed reads still has consequences... A vast-tools align crashed because the trimming generated fastq files now (rather than the fasta files that were as default before, as I understand).
Thanks (and sorry about that!).
==> Run command : ./vast-tools align /home/blencowe/blencowe20/shared/SEQ/EpiSC_B3_1-101.fq.gz /home/blencowe/blencowe20/shared/ SEQ/EpiSC_B3_2-101.fq.gz -sp Mmu -c 8 ==> Execution host : node50.ccbr.utoronto.ca [vast align]: Setting output directory to /home/blencowe/blencowe1/mirimia/vast-tools/vast_out [vast align]: Setting tmp directory.. [vast align]: Set tmp directory to /home/blencowe/blencowe1/mirimia/vast-tools/vast_out/tmp! [vast align]: Trimming fastq sequences to 50 nt sequences [vast trim]: Total processed reads: 232167743 [vast trim]: Total valid fwd reads: 232167743 [vast trim]: Total valid rev reads: 232167743 [vast align]: Doing genome substraction Error: reads file does not look like a FASTA file terminate called after throwing an instance of 'int'
gzip: stdout: Broken pipe bash: line 1: 29177 Exit 1 gzip -dc EpiSC_B3_1-101-50.fq.gz 29178 Aborted | bowtie -p 8 -f -m 1 -v 2 --un >(gzip > EpiSC_B3_1-101-50-e.fq.gz) --max /dev/null /home/blenco we/blencowe1/mirimia/vast-tools/VASTDB/Mmu/FILES/gDNA - /dev/null [vast align error]: bash -c gzip -dc EpiSC_B3_1-101-50.fq.gz | bowtie -p 8 -f -m 1 -v 2 --un >(gzip > EpiSC_B3_1-101-50-e.fq.gz) -- max /dev/null /home/blencowe/blencowe1/mirimia/vast-tools/VASTDB/Mmu/FILES/gDNA - /dev/null Failed in RunDBS_1.pl! at /home/blencow e/blencowe1/mirimia/vast-tools/bin/RunDBS_1.pl line 84. ==> Resources used : cput=10:53:54,mem=655080kb,vmem=1502588kb,walltime=06:00:29 ==> Exit status : 2
[mirimia@bc2 vast-tools]$ zcat vast_out/EpiSC_B3_1-101-50.fq.gz | more @isfkxpL3Btf/3LgNXySNKg-c4ca NGCAGGAAGGGTGGGCTCATCCCTCCTACCATCTCACACTGGATCAAAAA +isfkxpL3Btf/3LgNXySNKg-c4ca
@isfkxpL3Btf/3LgNXySNKg-c81e CTACCATCTCACACTGGATCAAAAAAAAGGATGAGTCGTGTAGTAGAGGT +isfkxpL3Btf/3LgNXySNKg-c81e
@isfkxpL3Btf/3LgNXySNKg-eccb AAAGGATGAGTCGTGTAGTAGAGGTTTGTCTAATGAGTTCTCAATAGCTA +isfkxpL3Btf/3LgNXySNKg-eccb