Closed HaoWangLYL closed 1 year ago
Hi, what do you mean by applying an example_run order? If you'd like to re-create the example run, you can use a command
{TRASH_dir}/TRASH_run.sh {TRASH_dir}/example_run/CP068268_39050443_39150442.fa --o {output_dir}
i want to know how to use the HOR module, because when i use this pipline in the given order, it cant product the result and png about HOR.
The HOR module requires repeat classification, so only one repeat family is analysed. The first step is to add a sequence template information that will be used for this classification. For example a file called "sequence_template.csv" that looks like:
name,length,seq
CEN178,178,AGTATAAGAACTTAAACCGCAACCGATCTTAAAAGCCTAAGTAGTGTTTCCTTGTTAGAAGACACAAAGCCAAAGACTCATATGGACTTTGGCTACACCATGAAAGCTTTGAGAAGCAAGAAGAAGGTTGGTTAGTGTTTTGGAGTCGAATATGACTTGATGTCATGTGTATGATTG
It can be used to classify Arabidopsis thaliana CEN178 repeats. In the output, these will have a "CEN178" class assigned. Add "--seqt {dir}/sequence_template.csv" to the command to use them.
With that, CEN178 repeats are available for the HOR analysis by adding "--horclass CEN178" to the command.
A full command that will include a HOR run looks like:
{TRASH_dir}/TRASH_run.sh {fasta_dir}/xxx.fa --o {output_dir} --seqt {dir}/sequence_template.csv --horclass NNN
Why in my results all the calss is NA?
Why in my results all the calss is NA? 635169288 @.***
See the comment above. Without appropriate sequence templates, no class will be assigned (NA).
yes, i got it.thank you
hello
can you apply an example_run order? thank you