search

voutcn / megahit

Ultra-fast and memory-efficient (meta-)genome assembler
http://www.ncbi.nlm.nih.gov/pubmed/25609793
GNU General Public License v3.0
588 stars 134 forks source link

megahit_core/toolkit problems with contig2fastq #311

Open JHarrisonEcoEvo opened 3 years ago

JHarrisonEcoEvo commented 3 years ago

It seems like there is still some problems with legacy megahit_toolkit commands not working.

I just tried the following command to convert contigs to fastg:

megahit_core contig2fastq 99 ../intermediate_contigs/k99.contigs.fa > k99.contigs.fastg

I also tried the previous accepted command of:

megahit_toolkit contig2fastq 99 ../intermediate_contigs/k99.contigs.fa > k99.contigs.fastg

Both provide the usage help to stdout but do not throw any errors or write anything to the output file. There is nothing germane in the usage prompt ( I copied it below for reference). My input contigs look like this (just first two contigs):

k99_0 flag=1 multi=3.0000 len=526
ACCCTGCTTTCCGAAGCGGGCGACACGGCCGCCGCGATCTCGGCCTTCTCGTCGATCGGCAAGGACCGCTCCGTTCCGGAAGCGATCCGCGATGCGGCCAAGCTGCGCGCCGGCTGGCTGCTGGTCGATACCGGCACCTATGAGCAGGTTTCCGCCGAGGTCGAGGAACTGTCGAATGACGGCAATCCGTTCCGCTTCTCCGCCCGCGAAATACTCGGACTGTCGGCCTATCGGCTGAAGGATTACACCCGCGCCCAGCAATGGTTCGAGGCGATTGCCAACGACCCGGAAGCCCCGCGCAACGTGCTCAACCGCGCCCAGATCATGCTCGAGGTGATGACCGCCGACGGCAATGTCGCCGAAAGCGCGGCCGGCCGATCAAGCTGTTCGACACCGCCGGCATGCGCCGCAAGGCGCGGGTGGTCGAAAAGCTGGAAAAGCTCTCGGTTTCCGACGCTCTGCGTGCGATCCGGTTTGCCGAATGCGTGGTGATCGTCTTCGATGCGACGATCCCGTTTGAAAAACA
k99_4539 flag=1 multi=3.0000 len=798
CAGCGCCTCGCCATTGTCTCCCACCAGGTCGGGGGCGAGCGCGCGAATGTCATAGGTCAGATCGACATCCTCGGAGAACCGCCGGATGACGCCATAGGCCTTCGACAGCGAAGTGCCGCCCTTGAATACCAGATGTTCGCCGAGCAGCGAGCCGTAGAGCGTGGCCAGCGCCCACACCACCCACGCATCCTTCTCCAGCAGGTGCGCGGGTCGGCCCGAGCGGTCGGCGGCAACGCTCAATGCTTCAAGGCGATCCTCGGCCGGAAGGAGGAGGAAGGGGTCAGCCATGCGCGACCTTACCCACGCTGCGCGCGAGCCAGGTCGGAAGCTGAGGCGCCGCCGCCACCAGCTCGCTGAAAGCGGCAGGCGGAAGCTTGCGCTTCAGGGTCTGGAGCGCCGACTCAGCCCTCTCCGGTCCGAGCCAAGCAAGCGCCCGCACCGCCTGTCCCGCCGGCCGATGCGCCATGGCAAGTTGCCAGCGCGGAGCGTGACGAAGCTCGACGGTCTGCTTGCCTAGGCTCATCTTCCGGGTGCGTCCCGAGGTCAGATAGACCGACCGGACCGGCACCTGCGTCGTAAGGCCGAGGCTGTTGGCGGCCGCCGCACCGCTTGAGACGATGACCTCGCCGCGCTGGGCTGCAAGCGCCTCAACCGCCTGCTCCACCGATGGCGCCCGGGTGCCGAACCGGCTCGTGACCGGCAGCAGATAAACACCTCGCCCGGCCCGAAGCAGTTGGCCCCGCTCGGCCAGACGCGACAAGGCCTGGTCCACCGCGGCGCGATTGCCAAGGTGGAGCA

What is printed when I run the above referenced calls to megahit_core or toolkit

Usage: megahit_core [sub options] sub-programs: assemble assemble from SdBG local local asssembly iterate extract iterative edges buildlib build read library count kmer counting read2sdbg build sdbg from reads seq2sdbg build sdbg from megahit contigs + edges contig2fastg convert MEGAHIT's k*.contigs.fa to fastg format readstat calculate read stats (# of reads, bases, longest, shortest, average) filterbylen filter contigs by length checkcpu check whether the run-time CPU supports POPCNT and BMI2 checkpopcnt check whether the run-time CPU supports POPCNT checkbmi2 check whether the run-time CPU supports BMI2 dumpversion dump version kmax the largest k value supported

ReneKat commented 2 years ago

Hi there, I'm on a Linux Ubuntu 20.04 running megahit v1.2.9 installed using conda . When I run megahit_core contig2fastg 127 ./intermediate_contigs/k127.contig.fa > k127.fastg the output file gets made immediately, but its empty. There's no error message. Is this command not being updated? Other than this minor issue, megahit is still an awesome tool. :) Thank you! -Rene