Open zj-wien opened 4 years ago
Hi,
Thanks for the email. When you run
/lustre/scratch117/sciops/team117/hpag/zn1/project/bird/hummingbird/QC/10x/bCalAnn1_S1_L001_R1_001.fastq.gz
this will produce a temporary directory which contains all the files. Could you do ls -lrt and send me the file list?
Best regards,
Zemin Ning
oops~ I deleted them all.
I think scaff_reads can only handle a certain volume of reads. Because scaff_reads works after I split the giant fastq file into ~15 files (6Gb gzipped file).
On Mon, May 11, 2020 at 11:30 AM Zemin Ning notifications@github.com wrote:
Hi,
Thanks for the email. When you run
/lustre/scratch117/sciops/team117/hpag/zn1/project/bird/hummingbird/QC/10x/bCalAnn1_S1_L001_R1_001.fastq.gz
this will produce a temporary directory which contains all the files. Could you do ls -lrt and send me the file list?
Best regards,
Zemin Ning
— You are receiving this because you authored the thread. Reply to this email directly, view it on GitHub https://github.com/wtsi-hpag/Scaff10X/issues/17#issuecomment-626587375, or unsubscribe https://github.com/notifications/unsubscribe-auth/ANTNC7VEYEBQXDFKQLTF5LTRQ7AUPANCNFSM4M44ZNAQ .
-- Zongji Wang
You can run scaff10x directly, rather than run staff_reads to get two read files, basically you don't need them. It saves disk space when you use "-data file.dat".
Hi there,
scaff_reads can only produce genome-BC_1.fastq.gz, but not genome-BC_2.fastq.gz. Here I list information as follows. Please help to fix it.
Thanks a lot
command line:
Scaff10X/src/scaff_reads -nodes 30 input.dat genome-BC_1.fastq.gz genome-BC_2.fastq.gz
# error information 58211 Segmentation fault Scaff10X/src/scaff-bin/scaff_BC-reads-2 MySample_S1_L001_R1_001.fastq.name MySample_S1_L001_R2_001.fastq MySample_S1_L001_R2_001.fastq.RC2 > try.out
cups & mem
SBATCH --cpus-per-task=30
SBATCH --mem=500G
input.dat
q1=MySample_S1_L001_R1_001.fastq (base size: 150Gb ) q2=MySample_S1_L001_R2_001.fastq (base size: 150Gb)
fastq
@CL100073098L1C001R001_7 CCCAATGGGACAATGGCAGGGCTGCCTATGGGGGAACCGGCATTGCTGTGAGGGTCGGGGGGACTATTGTATCTGTAAAGGATCAGCCATGGCCAGAAGTAGGTTTCTGAGCTGAGCGGTGACAGACTGTGCCCTTTTCCTGGCAGGAGG + @:GFFDFFFFF9FFFCFGFFDFGEFFE@FFFFFDEF@FF:F?DFGFF@FGFFFEDFEFFFGF;=FFFFGFFGGFFEBFCGE5F>BCFFBFFFFFFCF1BFAGFCDEFEF7FEFF,FGFADF3DBD=FFC84FFFGBFF7GF:DFDFF=EF @CL100073098L1C001R001_9 CTGCGTTTCGCGGCATGCTTTCTAGAAGCTTAAGTTGTCTGTTTTTCCACCCTCCAAATTGTCTGACCACTTGTTGATAGTAGCAATTCCATTTTAATACCTTATGTCATAAGTATTTTAAGCAACCAAAAGATTCCTTTATTTTTTGCA + FFFGFFFFFGGB;FFGGFEGEGEEGGCFGEEE=GFFGEGEGFFGGCEGFGDFGBFFBBGFEGDFEFEGBEFBBGGG:GGBDFDFDGGGF?ECF@F@GEAEAEEEEEGF>GDFDEEEECFF,GFFFE1FGGBEGCEG@EAC?DCGEAEB5@