Open francicco opened 5 years ago
Hi Francicco,
Are you running scaff10x on the same machine that you compiled it on?
Which version of gcc are you using and is it configured for the machine your running scaff10x on?
Hi @EdHarry,
Yes, it is the same machine. gcc/5.2.0 F
Ok, can you confirm it's the main scaff10x binary (src/scaff10x) that is seg faulting?
Yes!
ok, can you try some of the other binaries, say src/scaff-bin/scaff_matrix and src/scaff-bin/scaff_FilePreProcess, do they also seg fault?
They all return the help message, scaff10x
included.
F
I though you said the main binary seg faulted? is it seg faulting or printing a help message?
It is seg faulting when I execute it with the input files F
On Tue, 4 Jun 2019, 17:01 Ed Harry, notifications@github.com wrote:
I though you said the main binary seg faulted? is it seg faulting or printing a help message?
— You are receiving this because you authored the thread. Reply to this email directly, view it on GitHub https://github.com/wtsi-hpag/Scaff10X/issues/9?email_source=notifications&email_token=ACEW6FVJH4E5SCTJVNL4M4LPY2GWNA5CNFSM4HS5GYTKYY3PNVWWK3TUL52HS4DFVREXG43VMVBW63LNMVXHJKTDN5WW2ZLOORPWSZGODW5BSOY#issuecomment-498735419, or mute the thread https://github.com/notifications/unsubscribe-auth/ACEW6FVEWXZ6CSI7CDYAUD3PY2GWNANCNFSM4HS5GYTA .
Ok, could you tell me the full command you're executing, and could you provide the log of all the output please.
also, could you try the last stable release https://github.com/wtsi-hpag/Scaff10X/archive/v4.1.tar.gz and see if that works for you
This is the command line:
scaff10x -nodes 32 Diul10x.1.80.curated.2r0.05e30000l5a0.9.BWA.ARCS.fasta /home/fc464/rds/rds-shm37-helixmbodyw/HeliconiiniProg/10xChromium/fastq/Diul/Diul.LinkedReads.R1.fastq.gz /home/fc464/rds/rds-shm37-helixmbodyw/HeliconiiniProg/10xChromium/fastq/Diul/Diul.LinkedReads.R2.fastq.gz Diul10x.1.80.curated.2r0.05e30000l5a0.9.BWA.ARCS.scaff10x.fasta
Now I test the other version
F
That version works. Specifically the binary in src
not in src/scaff-bin
One last question. How do I have to format the fastq files. Is the barcode needs to be included the read sequence of header. If in the header, how?
Thanks a lot F
Hi Francicco,
Could you send me the information of all the files in the working directory? Either here or via email ( zn1@sanger.ac.uk ). It would tell me roughly it failed at which stage. You just do
ls -lrt tmp*
Zemin
One last question. How do I have to format the fastq files. Is the barcode needs to be included the read sequence of header. If in the header, how?
Thanks a lot F
You don't need to format the fastq files, the barcodes will be extracted from the reads automatically
So, this is how my fastq are formatted:
@D00352:461:CCYW4ANXX:2:1101:16223:19699_AAAAAAAAACCAGAAA
TAACTAAGAATTCGAAAGAAGATTCGAACTCGCGCCTCCTGAATACCGTCCGGGCGCTCTCACCACTAAGCCATGCGTTCTACTACAAGCTGCGTCGAAATT
+
BFB<<FF<F/F///<FF/FF/<<<//</</<B<<B/BF<F<F/<<FF////F///7<BF</<B7BF//<BFF<B//7B<B/7B/B/BB/B/BF/////B7F<
@D00352:461:CCYW4ANXX:3:1205:1151:93622_AAAAAAAAAGTACCAA
GAAAAACAAAAAAAAAACGAACTACTTTTATCAGATAACATTGTTCTTTGAGCACATTTACAAAATAGCGATTTCATTTCAAAAAAACTAATAATTCATTGT
+
BFBF/FFFFBFFFFFFF<//<B/FF/<F/F<////BFFFFB//</<FFFF<<BFBFFFBFFFFFFFFFB//B/7/FB/<//7BFBBBB7FB<FFFFB7B/77
@D00352:461:CCYW4ANXX:4:2307:1605:2891_AAAAAAAACAATTCCA
ATAGAGGATGAAAGTGGCAGTTCACGTGGCGAAGCCGCGAGCGGGTGGCTAGTAAACAATAAGCGAGTTATCTCACCAGGTAAAATGTTGAAACATGATTCA
+
FFFFFFFFFFFFFFFBFBF<<F/FFB/F/FFFFFFFBFFFFFFF<<BBFFFFFFFFFFFFFFFFFBFBFFFFFFBFFFFFFFFFFFBFFBFFFFFBB/FFFF
It's the format I used for ARCS
.
I tested break10x
with those reads using this command line:
break10x -nodes $THREADS $ASSEMBLY.fasta $R1 $R2 \
$ASSEMBLY.break10x.fasta \
$ASSEMBLY.BreakPoints
It produced the output files. The BreakPoints file contains 38 lines. Now I'm testing scaff10x
.
From what I understood break10x
finds errors and scaff10x
scaffold the contigs. On top of that I think you suggest to also use ARCS
. Is That right?
Do you still want the files? The newest version doesn't generate any file, it crashes immediately.
F
Yes, break10x finds errors and scaff10x scaffold the contigs. To use or not use ARCS is your choice. But it is good to compare.
Zemin
I just tested v4.2 in my computers and it works at various options.
I'll try to recompile it Thanks a lot
F
Reads in Diul.LinkedReads.R1.fastq.gz
are in this format:
@D00352:461:CCYW4ANXX:2:1101:16223:19699_AAAAAAAAACCAGAAA TAACTAAGAATTCGAAAGAAGATTCGAACTCGCGCCTCCTGAATACCGTCCGGGCGCTCTCACCACTAAGCCATGCGTTCTACTACAAGCTGCGTCGAAATT + BFB<<FF<F/F///<FF/FF/<<<//</</<B<<B/BF<F<F/<<FF////F///7<BF</<B7BF//<BFF<B//7B<B/7B/B/BB/B/BF/////B7F< @D00352:461:CCYW4ANXX:3:1205:1151:93622_AAAAAAAAAGTACCAA GAAAAACAAAAAAAAAACGAACTACTTTTATCAGATAACATTGTTCTTTGAGCACATTTACAAAATAGCGATTTCATTTCAAAAAAACTAATAATTCATTGT + BFBF/FFFFBFFFFFFF<//<B/FF/<F/F<////BFFFFB//</<FFFF<<BFBFFFBFFFFFFFFFB//B/7/FB/<//7BFBBBB7FB<FFFFB7B/77 @D00352:461:CCYW4ANXX:4:2307:1605:2891_AAAAAAAACAATTCCA ATAGAGGATGAAAGTGGCAGTTCACGTGGCGAAGCCGCGAGCGGGTGGCTAGTAAACAATAAGCGAGTTATCTCACCAGGTAAAATGTTGAAACATGATTCA + FFFFFFFFFFFFFFFBFBF<<F/FFB/F/FFFFFFFBFFFFFFF<<BBFFFFFFFFFFFFFFFFFBFBFFFFFFBFFFFFFFFFFFBFFBFFFFFBB/FFFF
The format used for ARCS also should work for scaff10x. Make sure that your target assembly is in the working directory and two read files are with correct links.
you mean ln TARGET LINK_NAME
in the same directory where the assembly is?
F
Hi Francicco,
If you're still having problems, could you try making small test files from your target assembly and 10x data with a few reads in them (keep them below 1M in size) and see if running with them still causes a seg fault? If it does could you upload the files here please.
It looks like I don't have the segmentation fault anymore. Maybe because I generate the soft links.
The 4.1 worked pretty well my assembly looks better adding breck10x and scaff10x to my pipeline than before! Thanks F
Good to hear that.
Zemin
Hi,
I just downloaded and installed the program:
But when I execute it I get a
317644 Segmentation fault
What's wrong? Thanks F