does not contain split symbol

TKsh6 commented 2 years ago

When I was running this command: coverm genome -m relative_abundance -b ./coverm_filter_res/${each_id}.filter.bam -s c -o ./abundance/${each_id} --threads 18 I encontered this problem:

[2022-05-19T04:29:06Z INFO  coverm] CoverM version 0.6.1
[2022-05-19T04:29:06Z INFO  coverm] Writing output to file: ./abundance/ERR5766183
[2022-05-19T04:29:06Z INFO  coverm] Using min-covered-fraction 10%
thread 'main' panicked at 'Contig name k141_36901 does not contain split symbol, so cannot determine which genome it belongs to: "Element not found in slice"', src/genome.rs:813:54
note: run with `RUST_BACKTRACE=1` environment variable to display a backtrace

How can I do to deal with this?

Yours S

wwood commented 2 years ago

Hi,

-s defines a character in a contig name that separates the genome name from the contig name. For instance in

>genome1=contig43

You would use -s =. You've specified -s c but c is not a character in k141_36901 so CoverM croaks.

HTH, ben

TKsh6 commented 2 years ago

Thank you for your response! Besides, the contig name is just like this, so what kind of -s should I use?

>k141_6380
TATTTGGCTTATATCTAGATGCCTGCATCCAGTTAAAGTATGGTCCCTTAATAACATCTC
CAAACTATATTGCTGGAAAGAGTCTAAGAAAGAAATATGATCCTGCTTTTATTGAAAAAA
TAAAGGATATGGAAAACAAAGCGTAACAAAAATATTGTTGTTGTAGAAAAAGTATGCT

TKsh6 commented 2 years ago

Thanks, I have done it.

wwood commented 1 year ago

Hmm, how should coverm know which contigs belong to which genomes?

-------------- Ben Woodcroft Group leader, Centre for Microbiome Research, QUT

From: TKsh6 @.> Sent: Thursday, May 19, 2022 5:07:31 PM To: wwood/CoverM @.> Cc: Ben J Woodcroft @.>; Comment @.> Subject: Re: [wwood/CoverM] does not contain split symbol (Issue #116)

Thank you for your response! Besides, the contig name is just like this, so what kind of -s should I use?

k141_6380 TATTTGGCTTATATCTAGATGCCTGCATCCAGTTAAAGTATGGTCCCTTAATAACATCTC CAAACTATATTGCTGGAAAGAGTCTAAGAAAGAAATATGATCCTGCTTTTATTGAAAAAA TAAAGGATATGGAAAACAAAGCGTAACAAAAATATTGTTGTTGTAGAAAAAGTATGCT

― Reply to this email directly, view it on GitHubhttps://github.com/wwood/CoverM/issues/116#issuecomment-1131309509, or unsubscribehttps://github.com/notifications/unsubscribe-auth/AAADX5HUXAWBAUXW6UGQXA3VKXSDHANCNFSM5WK46PHQ. You are receiving this because you commented.Message ID: @.***>

wwood / CoverM

does not contain split symbol #116