stage one fails and makes empty output directory

[osvatic]

Hello,

I have args_oap installed through the conda instructions provided but stage_one fails and produces and empty output directory

[osvatic@login01 Metabolic_C]$ args_oap stage_one -i test -o output -f fa -t 32
[2023-05-10 13:04:06] INFO: Building databases ...
[osvatic@login01 Metabolic_C]$ cd output/
[osvatic@login01 output]$ ls
[osvatic@login01 output]$ 

I have been testing with 2 files that look like this:

file 1

>HWI-A00245_BSF_1099:1:2101:10158:29262#JMF_2107_07_0004_S104725
AGCGCAAGCCCGGCGCCTTGCGCAACGGCGCGCCGTTCGCTGACATGCCCGATCCGCTGCGC
>HWI-A00245_BSF_1099:1:2101:10158:30013#JMF_2107_07_0004_S104725
TGCGCGCCTTGCGGGCAACCGGCGATGCGCGCATAGTCGTTGACGGAGGTCAGGATGATCAAGGCAGTCAAGTTCGTGAGCGTGCCGGTCAAGGATCAGGA
>HWI-A00245_BSF_1099:1:2101:10158:30295#JMF_2107_07_0004_S104725
CCCGGCAACGTTTTAAAATTCCGTTTTGATAATATTATGTTGCCAGACAGCGGTTCAAACGAGCCTCAAAGTCACGGGTACGTGATTTACGAAATTAAACC

file 2

>HWI-A00245_BSF_1099:1:2101:10158:29262#JMF_2107_07_0004_S104725
AGCGCAAGCCCGGCGCCTTGCGCAACGGCGCGCCGTTCGCTGACATGCCCGATCCGCTGCGC
>HWI-A00245_BSF_1099:1:2101:10158:30013#JMF_2107_07_0004_S104725
TGCGCGCCTTGCGGGCAACCGGCGATGCGCGCATAGTCGTTGACGGAGGTCAGGATGATCAAGGCAGTCA
AGTTCGTGAGCGTGCCGGTCAAGGATCAGGA
>HWI-A00245_BSF_1099:1:2101:10158:30295#JMF_2107_07_0004_S104725

Is there a known issue or way to troubleshoot this?

[xinehc]

Hi,

I suspect it's an issue with blast/diamond installation. The database is not successfully built.

Maybe try installing args_oap in a new conda environment using:

conda create -n args_oap -c bioconda -c conda-forge args_oap
conda activate args_oap

If the error persists, could you please show the results of the following command

conda list | grep -E 'diamond|blast|args_oap'

What are the filenames in folder test? It is also possible that no valid fasta/fastq files has been detected.

[jowodo]

Hi, thanks for the quick reply. I'm working on the same installation as @osvatic. Installation:

conda config --set channel_priority flexible
conda config --set solver libmamba
conda create -y -n args_oap-3.2.2 -c conda-forge -c bioconda args_oap=3.2.2

Conda environment:

$ conda list | grep -E 'diamond|blast|args_oap'
# packages in environment at /home/apps/conda/miniconda3/envs/args_oap-3.2.2:
args_oap                  3.2.2              pyhdfd78af_0    bioconda
blast                     2.13.0               hf3cf87c_0    bioconda
diamond                   2.1.6                h5b5514e_1    bioconda

Following the example from the README.md file:

$ wget -q https://dl.dropboxusercontent.com/s/pqgftlo24rfc2rd/example.tar.gz
$ tar -xf example.tar.gz
$ cd example
$ args_oap stage_one -i input -o output -f fa -t 8
[2023-05-12 10:35:25] INFO: Building databases ...
$ args_oap stage_two -i output -t 8
[2023-05-12 10:35:32] CRITICAL: File "metadata.txt" does not exist in input folder <output>. Please run <stage_one> first or check input folder (-i/--indir).
]$ ls *
input:
STAS_1.fa  STAS_2.fa  SWHAS104_1.fa  SWHAS104_2.fa

output:

[xinehc]

Please make sure you have the write permission to folder /home/apps/conda/miniconda3/envs/args_oap-3.2.2

You may use chmod -R a+rw /home/apps/conda/miniconda3/envs/args_oap-3.2.2 to grant the permission.

[jowodo]

Hi!

This is a central installation. That means I don't have permissions to change permission. I installed the environment into my homedir where I do have write permissions and it worked like a charm. Would it be possible to release a centrally installable version in future? Which files in the environment need write access?

Thanks!

[xinehc]

Which files in the environment need write access?

The first time you run args_oap it will built a database for blast/diamond and write these files to the folder.

Would it be possible to release a centrally installable version in future?

We may release a version that contains pre-built databases later.

[jowodo]

Running the test after installation as admin worked:

conda create -y -n args_oap-3.2.2 -c conda-forge -c bioconda args_oap=3.2.2
conda activate args_oap-3.2.2
TD=$(mktemp -d)
pushd $TD
wget -q https://dl.dropboxusercontent.com/s/pqgftlo24rfc2rd/example.tar.gz
tar -xf example.tar.gz
cd example
args_oap stage_one -i input -o output -f fa -t 8
args_oap stage_two -i output -t 8
popd
rm -rf $TD

Now I can run the test successfully as non-privileged user. It might be helpful for others to put a short note in the README file that for central installations the test should be performed once as admin user.

Thanks!