-
Will RDscan take a single FASTQ read? It looks like it cannot but would like to double check. If it can take a single read what will be the syntax to use in the config/samples.tsv file?
-
roachtest.follower-reads/mixed-version/survival=region/locality=global/reads=strong [failed](https://teamcity.cockroachdb.com/buildConfiguration/Cockroach_Nightlies_RoachtestNightlyGceBazel/17904740?b…
-
-
Hi,
Thank you for the tool and insightful ideas!
I ran LocusMasterTE on my dataset, combining long-read and short-read quantification for TEs. However, I noticed that for some TEs supported by u…
-
Using `picotool info -a` takes a while due to multiple flash reads, for the multiple scans for metadata blocks. This could be improved by caching the data read from flash in the `picoboot_memory_acces…
-
**Note:** This build has runtime assertions enabled. If the same failure was hit in a run without assertions enabled, there should be a similar failure without this message. If there isn't one, th…
-
fastplong -w 128 -Q -i ont.fq.gz -o fastplong.fq.gz
Trying to detect adapter sequence at read start
Detected: TGTACTTCGTTCAGTTACGTATTGCT
Trying to detect adapter sequence at read end
Found possib…
-
Hi there,
thanks a stack for conceiving and maintaining fsspec. We are successfully using it in a few projects and never observed any kinds of issues so far. 💯
Right now, we may have discovered …
amotl updated
2 weeks ago
-
`_get_reads_length` returns nothing when the constant `NO_READS_READLEN` is not exceeded in the final if condition, propagating an undefined variable down the chain until the program crashes. We've go…
-
We observed that in the **metrics_summary.xls** file under **04.report**, the cDNA Number of reads is **1,858,750,737**, but in the **anno_decon_sorted.bam** file under the **output** directory, there…