-
Hello,
I have a question about the deconvolution process. As I understand it, there are 2 steps: (1) segmentation by watershed algorithms that gives the cell_count and (2) deconvolution by alignment…
-
Hi,
Can we perform gene imputation using cell2location ? (This is what can do with Tangram)
-
Greetings,
I am using Tangram to annotate my spatial data (10X) using single cell data. I would like to better understand the output of project_cell_annotations().
It says “INFO:root:spatial p…
-
Hello, I am interested in using Tangram to integrate my Visium/single cell data and I wanted to better understand the output of `project_cell_annotation ` stored in `tangram_ct_pred`. Are these values…
-
It seems that the pipeline configuration of tangram is not correct?
> ./gkno pipe fastq-tangram -r resources/homo_sapiens/current/human_reference_v37_decoys.fa -mr resources/homo_sapiens/current/mob…
-
I am working on bam files that were generated from BWA-MEM with the output in following format:
ERR194147.232367647 65 1 9998 0 67M34S 5 18606756 0 GGATAACCCTAACCCTAACCCTAACCCTAACCCTA…
-
Tested on Sept 18th, 2018 build (https://github.com/Triang3l/xenia/tree/d3d12)
# Issues:
Doesnt load at all. Just gives a white screen. The log might have something
# Log:
[xenia.zip](https…
-
Islands are important and often notable map features, and island labels should be included in the tiles.
With the island's geometry (if it's a multipolygon relation), it should be possible to infer…
-
Some nice shaders on here. I have a variety of DeckGL layers that would look great on top of these. Has any one suceeded in interweaving the 2 frameworks?
Im trying to work out what would best deck…
-
https://ywhfamily.com/post/tangram-polyform/
Logic & Math Puzzles