-
![Screenshot 2024-10-01 211546](https://github.com/user-attachments/assets/0dfb2c30-89ce-491a-835a-6ed73e325817)
-
MWE:
```tex
\documentclass{swathesis}
%\documentclass{scrbook}
\usepackage{tabularray}
\UseTblrLibrary{siunitx}
\begin{document}
\begin{table}
\begin{tblr}{
|
X[si={table-ali…
-
MWE:
```tex
\documentclass{scrbook}
\usepackage{colortbl}
\usepackage{tabularray}
\UseTblrLibrary{siunitx}
\begin{document}
\begin{table}
\begin{tblr}{
|
X[si={table-alignmen…
-
This issue was created to fix the logo alignment bug. We expected the logo to be centred.
-
Sorry about spamming feature request lately! But I'm happy I've found a Lua-formatter/style checker that works for most of my needs!
Here's something I do with my code often, and I wonder if this cou…
-
I'm trying to perform two alignments with AGAThA of sequences about 200bp each. Here are the input files I'm using:
`query_test.fasta`
```
>0
GGATATAGGGGTAGCACTTGATACGGTAGCGGGCTCATTGGAGCATCCGAAT…
-
- fix the mismatch of left alignments and center alignment of text on the smaller view ports on the about page
-
### Checklist
- [X] I have searched the [existing issues](https://github.com/streamlit/streamlit/issues) for similar issues.
- [X] I added a very descriptive title to this issue.
- [X] I have provide…
-
This meeting is at NES (10AM). Attendance is a must.
-
`RomAlignerReliable` now reliably aligns bits when the image is straight or reasonably tilted, but it becomes confused when a large gap exists between two sides of the ROM.
![image](https://github.…