-
Hi, thank you for the fantastic package!
I initially ran TRUST4 with an earlier version that I guess did not output in an airr format. I know you can convert the existing barcode report to this for…
-
-
-
@aditigopalan here is a checklist for us to work through on Monday
- [x] Code review
- [x] Confirmed happy to procede
- [x] Set project ACLs
- [x] ohsu: syn22093319
- [x] bu: syn22124336
…
-
When I run MAESTRO on the ATACseq tutorial (atac_pbmc_500_nextgem), I get the above error. If I probe further, the error is:
Error in irlba(A = t(x = object), nv = n, work = irlba.work) :
max(nu,…
-
Hi,
I'm running into issue when running eval.py:
`CUDA_VISIBLE_DEVICES=0 python $EVAL --drop_out --k 10 --models_exp_code $DATA_ROOT_DIR/training_2/results/task_2_tumor_subtyping_CLAM_75_s1 --save_e…
-
http://rafalab.dfci.harvard.edu/dsbook-part-2/prob/discrete-probability.html#monte-carlo-example
```
(hands[1] %in% aces & hands[2] %in% facecard) |
(hands[2] %in% aces & hands[1] %in% facecar…
-
Search for shRNA sequence GTGAAGAATGTGACAAAGTTT finds two observations, but from the search page it is not possible to go to shRNA page https://ctd2-dashboard.nci.nih.gov/dashboard/#rna/gtgaagaatgtgac…
-
Hello,
I'm running into the following error when trying to run create_heatmaps.py:
`CUDA_VISIBLE_DEVICES=0 python /n/data1/dfci/medicine/beltran/lab/lwei/Software/CLAM_install/CLAM/create_heatmaps…
-
Hi,
I recently updated my R and RStudio (along with the necessary tools and java) on a Mac M2 (Sonoma OS) and now I am receiving an error message when attempting to run detect_batch_effect_express…