-
Hi,
Annovar did not manage to pass the command (annotate_variation.pl) with this kind of variant :
chr5 176942300 176942373 ACTTTCTCAGAGCCCCAAAGCCTGTAAAACTGGCACTACCCCTACAAGTTGCAGATGATGAAACTGAGGC…
-
**Submitting author:** @kumiori (Andrés A. León Baldelli)
**Repository:** https://github.com/kumiori/irrevolutions
**Branch with paper.md** (empty if default branch): andres-paper
**Version:** v1
**Ed…
-
### Description
Using a custom block variation and selecting it in the block inspector does not show the 'is-pressed' css class.
The selected varation does in fact get shown in the editor, it is j…
-
It should be possible to do an [equivalent, although much trickier](https://gitlab.com/nbdkit/nbdkit/-/blob/master/common/utils/exit-with-parent.c#L84-159), variation of [what we currently do for Linu…
-
Let's add some style variations to this theme
-
### Description
This bug is tricky to explain in words, so I recommend watching the video below. Basically, if you have set your site to a specific style variation and then make a change to the JSON …
-
With the wizard and about modal now as children of the modal component, they both have custom heights that we might reconsider in general and whether they belong on the individual components, or if it…
-
I figure this is probably goes along with adding support for hinting. However there is some fonts where a lot of data is missing because of the lack of support for Font Variations. The two major varia…
-
This task is will help to extend the OETP disclosure schema and make it useful for wider set of applications.
-
There's some really nice plotting functions in the new AgamPrimer package by @sanjaynagi for investigating whether there is any variation within a specific genome region that might affect primer bindi…