-
Greg Leppert is reading this because of you
Jud is reading this because of Greg Leppert
You are reading this because of Greg Leppert
... just doesn't seem right.
-
For review: openjournals/joss-reviews#5701
When `nice_fit(..., nice_table = TRUE)`, there is a bottom row of "ideal values", with a table footnote indicating they were "proposed by Schreiber (2017)…
-
_Submitted by:_ **Ladislav**
The examples below demonstrate an inconsistency in handling an (otherwise unseparated) VALUE TAG sequence of characters.
``` rebol
>> load "1.2.3"
** Syntax error: inval…
-
All (probably all, I would need to check in detail), the references in the device adaptation spec to viewports are actually about the layout viewports, so the initial viewport is about the initial lay…
-
There are valid words/sentences that contain hypens or dashes and should be supported when adding a recipe into CookHub. Such words are also not uncommon in titles/description/steps of cookbooks. (tit…
-
Hi 👋
Very cool project, I watched some of the video that you posted on YouTube. I just had a few questions I was curious about, I hope you don't mind answering. FWIW I'm personally not as familiar …
-
Post questions here about the following exemplary reading:
Dodds, Peter Sheriden et al. 2015. “[Human language reveals a universal positivity bias.](https://www.pnas.org/content/pnas/112/8/2389.ful…
-
If you have a long title, many affiliations with many authors and a teaser image, somehow there is an empty first page.
Here is sample code that causes the error right away with the template only:
…
-
I will be coding a horror story with a monster in it. I plan to do a mix of templating and something else (probably simulation). This is because I'd like to produce something with a coherent sense of …
-
Hi, jeffdaily, thanks for your great work!
Let's start with an exmple. When I do a global alignment for these two sequences:
```
seq1: CAGGACGAGGAGCAGAGGACAAGGAGGAT
seq2: CAGGACGAGGAGCAGAGGCTTAAG…